G181005


Basic Information

Item Value
gene id G181005
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 34106560 ~ 34107908 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU245156
attcaactaacactgaattgaatgtccattaaatttaacttaaccctatgttgaatgtaaatgattcaaaatagaaccaaaccctacacctaaccctaaccttaacccttaatcaaccataaaatcaaaccctacaccttaccctaaccttaacccttaatcaaccctaaaatcaaaccctacacctaaccttaaccctaacccttaatcaaccataaaatcaaaccctacacctaaccctaaccttaacccttaatcaaccctaaaatcaaaccctacacctaaccctta
>TU245157
aaatcaaaccctacacctaaccctaaccttaacccttaatcaaccctaaaatcaaaccctacaccttaccctaaccttaacccttaatcaaccctaaaatcaaaccctacacctaaccttaaccctaacccttaatcaaccataaaatcaaaccctacacctaaccctaaccttaacccttaatcaaccctaaaatcaaaccctacacctaaccctta

Function

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0019538 protein metabolic process biological_process
GO:0030162 regulation of proteolysis biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:0051246 regulation of protein metabolic process biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus
ko05020 Prion disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU245156 True 291 lncRNA 0.36 4 34106560 34107908
TU245157 False 218 lncRNA 0.39 3 34106560 34107695

Neighbor

gene id symbol gene type direction distance location
hunk hunk,LOC108423838,LOC107734458,LOC107577711,LOC107691675,LOC104954747 coding downstream 105100 33987072 ~ 34001460 (-)
eva1c NA coding downstream 170764 33921364 ~ 33935796 (-)
LOC107197575 NA coding downstream 271006 33833945 ~ 33835554 (-)
LOC103027380 LOC108438972,LOC108277286,LOC107718741,LOC107701146,LOC107555179,LOC105907404,LOC107720538,LOC107693876 coding downstream 359784 33526672 ~ 33746776 (-)
LOC107197574 arfip2b,LOC108438961,LOC108276920,LOC107557232,LOC107718740,LOC107555180 coding downstream 660445 33399355 ~ 33446115 (-)
zar1l NA coding upstream 400551 34508459 ~ 34510759 (-)
rfc3 rfc3,LOC107589808,LOC107728889 coding upstream 425266 34533174 ~ 34540077 (-)
LOC103021309 dclk1,LOC107728871,LOC107577778 coding upstream 967106 35075014 ~ 35164372 (-)
LOC111195093 NA coding upstream 1061878 35169786 ~ 35180741 (-)
spart NA coding upstream 1073490 35181398 ~ 35204110 (-)
G180958 NA non-coding downstream 182832 33918934 ~ 33923728 (-)
G180965 NA non-coding downstream 183479 33885724 ~ 33923081 (-)
G180957 NA non-coding downstream 196189 33881571 ~ 33910371 (-)
G180949 NA non-coding downstream 220295 33839407 ~ 33886265 (-)
G180893 NA non-coding downstream 311565 33794663 ~ 33794995 (-)
G181011 NA non-coding upstream 35691 34143599 ~ 34143805 (-)
G181030 NA non-coding upstream 146270 34254178 ~ 34254624 (-)
G181136 NA non-coding upstream 434678 34542586 ~ 34542867 (-)
G181252 NA non-coding upstream 806317 34914225 ~ 34945421 (-)
G181268 NA non-coding upstream 848280 34956188 ~ 35016656 (-)
LOC103033173 NA other downstream 250928 33805240 ~ 33855632 (-)
tiam1 tiam1,LOC108423828,LOC107718732 other downstream 1522217 32436325 ~ 32584343 (-)
tmem135 tmem135,LOC107701128,LOC107718730 other downstream 1843962 32240179 ~ 32262598 (-)
LOC103030555 LOC108423819,LOC107701125,LOC107718772,LOC107720543,LOC107556862,LOC107693906 other downstream 2034636 31894202 ~ 32071924 (-)
G180188 dyrk1a,LOC108411986,LOC107572954 other downstream 3148793 30946946 ~ 30957767 (-)
LOC103042595 LOC106931471,LOC106940241,LOC106603438,LOC107659943,LOC101067200 other upstream 1325324 35433232 ~ 35470789 (-)

Expression


Co-expression Network