G69223


Basic Information

Item Value
gene id G69223
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 659177 ~ 659462 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU78938
GTCTTATCTGAATTTAATAGAAGAAAATTACTCATCCAATGTTTTACTTCTTTAACACACTCTGTCAGATTGGATAATTTGGAGATTTCATCTGGTCGTGATGAAATATATAACTGAGTATCATCGGCATAGCAGTGGAAACTAATTCCATGTTTTCTTATAATATCACCAAGTGGCAGCATATATATTGAAAATAACAGAGGGCCTAACACAGATCCTTGTGGCACTCCATAATTTACTATCGTTATCTTAGATTTTTCCCCGTTTAAATAGACAAAATTGTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU78938 True 286 lncRNA 0.33 1 659177 659462

Neighbor

gene id symbol gene type direction distance location
CI01000012_00647774_00648451 NA coding downstream 10232 647586 ~ 648945 (-)
CI01000012_00520655_00552630 NA coding downstream 105357 520139 ~ 553820 (-)
CI01000012_00427641_00472235 NA coding downstream 186600 427573 ~ 472577 (-)
CI01000012_00382850_00384215 NA coding downstream 274751 381711 ~ 384426 (-)
CI01000012_00340814_00363240 HAAO coding downstream 295937 340665 ~ 363240 (-)
CI01000012_00686760_00686993 NA coding upstream 27059 686521 ~ 686993 (-)
CI01000012_00689933_00695237 NA coding upstream 29632 689094 ~ 695264 (-)
CI01000012_00863269_00864644 NA coding upstream 202578 862040 ~ 865072 (-)
CI01000012_00866804_00867133 NA coding upstream 206523 865985 ~ 867133 (-)
CI01000012_00904582_00908136 NA coding upstream 244989 904451 ~ 909518 (-)
G69222 NA non-coding downstream 969 657967 ~ 658208 (-)
G69193 NA non-coding downstream 31492 627342 ~ 627685 (-)
G69157 NA non-coding downstream 75943 582794 ~ 583234 (-)
G69154 NA non-coding downstream 79638 577984 ~ 579539 (-)
G68623 NA non-coding downstream 131871 526939 ~ 527306 (-)
G69224 NA non-coding upstream 2297 661759 ~ 662263 (-)
G69180 NA non-coding upstream 8534 667996 ~ 668238 (-)
G69235 NA non-coding upstream 17546 677008 ~ 677714 (-)
G69234 NA non-coding upstream 18457 677919 ~ 678475 (-)
G69237 NA non-coding upstream 26114 685576 ~ 686162 (-)
G69161 NA other downstream 71162 587604 ~ 588015 (-)
G69150 NA other downstream 92221 565463 ~ 566956 (-)
CI01000012_00178282_00181473 NA other downstream 479215 178182 ~ 183012 (-)
G69277 NA other upstream 70458 729920 ~ 730465 (-)
G69332 NA other upstream 115902 775364 ~ 775879 (-)
CI01000012_01139864_01192154 TTC7A other upstream 476214 1135676 ~ 1192154 (-)
G69562 NA other upstream 672613 1332075 ~ 1376298 (-)
G70774 NA other upstream 2207046 2866508 ~ 2866892 (-)

Expression


Co-expression Network