G69357


Basic Information

Item Value
gene id G69357
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 802919 ~ 803140 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU79102
GGACTCCAATAGAGGTATATGCAATCTGCCACCCAACAGTCAGCCTCTACTCCATCTTGCCATTGACAGCTAACTGTTCCATAAACAAGGACAAATCCAGCATGAATTCCACAGCGCCTGGCAGACGTTGCCCTCTCTCTGGTCTTTTCATGATTTTGCTCTCTTTCTTTCTGTCTCCCTCCCTCCACTTTGTCTTTTGTTGCAGGGATCCCTGAAAGGCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU79102 True 222 lncRNA 0.48 1 802919 803140

Neighbor

gene id symbol gene type direction distance location
CI01000012_00689933_00695237 NA coding downstream 107655 689094 ~ 695264 (-)
CI01000012_00686760_00686993 NA coding downstream 115926 686521 ~ 686993 (-)
CI01000012_00647774_00648451 NA coding downstream 153974 647586 ~ 648945 (-)
CI01000012_00520655_00552630 NA coding downstream 249099 520139 ~ 553820 (-)
CI01000012_00427641_00472235 NA coding downstream 330342 427573 ~ 472577 (-)
CI01000012_00863269_00864644 NA coding upstream 58900 862040 ~ 865072 (-)
CI01000012_00866804_00867133 NA coding upstream 62845 865985 ~ 867133 (-)
CI01000012_00904582_00908136 NA coding upstream 101311 904451 ~ 909518 (-)
CI01000012_00955355_00975846 THADA coding upstream 152215 955355 ~ 975880 (-)
CI01000012_01032204_01034843 NA coding upstream 228829 1031969 ~ 1034843 (-)
G69342 NA non-coding downstream 13519 789053 ~ 789400 (-)
G69341 NA non-coding downstream 15202 787496 ~ 787717 (-)
G69334 NA non-coding downstream 23044 779646 ~ 779875 (-)
G69332 NA non-coding downstream 27173 775364 ~ 775879 (-)
G69305 NA non-coding downstream 33010 769659 ~ 769909 (-)
G69360 NA non-coding upstream 3370 806510 ~ 806787 (-)
G69444 NA non-coding upstream 269828 1072968 ~ 1073173 (-)
G69314 NA non-coding upstream 313762 1116902 ~ 1118110 (-)
G69497 NA non-coding upstream 401169 1204309 ~ 1204539 (-)
G69498 NA non-coding upstream 402035 1205175 ~ 1205413 (-)
G69277 NA other downstream 72454 729920 ~ 730465 (-)
G69161 NA other downstream 214904 587604 ~ 588015 (-)
G69150 NA other downstream 235963 565463 ~ 566956 (-)
CI01000012_00178282_00181473 NA other downstream 622957 178182 ~ 183012 (-)
CI01000012_01139864_01192154 TTC7A other upstream 332536 1135676 ~ 1192154 (-)
G69562 NA other upstream 528935 1332075 ~ 1376298 (-)
G70774 NA other upstream 2063368 2866508 ~ 2866892 (-)
G71898 NA other upstream 3730390 4533530 ~ 4534672 (-)
G72068 NA other upstream 3973080 4776220 ~ 4780132 (-)

Expression


Co-expression Network