G69497



Basic Information


Item Value
gene id G69497
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 1204309 ~ 1204539 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU79270
GGGCAGACAGATCTCTCATCGCTGGAAACTTATTTCATCACACCTGGTTAGGAAATTTGTCTGGATTATTGTAGAACTGTATTGATGTATTTAGTTCTTGACCACTGGTAAAACATCTATTATAATATATGACATGTTAGTGATTTAAATGTTGCTGGAAAGAAAATTACCTTTTGAATGGCCACCAACATATAACATATAACACAGCTAACTTTCCATGTTACCCAGCCA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU79270 True 231 lncRNA 0.35 1 1204309 1204539

Neighbor


gene id symbol gene type direction distance location
CI01000012_01139864_01192154 TTC7A coding downstream 12155 1135676 ~ 1192154 (-)
CI01000012_01032204_01034843 NA coding downstream 169466 1031969 ~ 1034843 (-)
CI01000012_00955355_00975846 THADA coding downstream 228429 955355 ~ 975880 (-)
CI01000012_00904582_00908136 NA coding downstream 294791 904451 ~ 909518 (-)
CI01000012_00866804_00867133 NA coding downstream 337176 865985 ~ 867133 (-)
CI01000012_01240945_01242653 SOCS5, SOCS5B coding upstream 35978 1240517 ~ 1242653 (-)
CI01000012_01256938_01257273 PRKCE coding upstream 51178 1255717 ~ 1257273 (-)
CI01000012_01489297_01490202 CDC42EP3 coding upstream 284291 1488830 ~ 1490313 (-)
CI01000012_01601665_01604244 CYP1B1 coding upstream 397115 1601654 ~ 1604353 (-)
CI01000012_01677949_01691893 POLR1B coding upstream 473365 1677904 ~ 1692036 (-)
G69314 NA non-coding downstream 86199 1116902 ~ 1118110 (-)
G69444 NA non-coding downstream 131136 1072968 ~ 1073173 (-)
G69360 NA non-coding downstream 397522 806510 ~ 806787 (-)
G69357 NA non-coding downstream 401169 802919 ~ 803140 (-)
G69342 NA non-coding downstream 414909 789053 ~ 789400 (-)
G69498 NA non-coding upstream 636 1205175 ~ 1205413 (-)
G69508 NA non-coding upstream 11897 1216436 ~ 1216672 (-)
G69509 NA non-coding upstream 12912 1217451 ~ 1217756 (-)
G69545 NA non-coding upstream 98961 1303500 ~ 1361825 (-)
G69517 NA non-coding upstream 120377 1324916 ~ 1330508 (-)
G69332 NA other downstream 428430 775364 ~ 775879 (-)
G69277 NA other downstream 473844 729920 ~ 730465 (-)
G69161 NA other downstream 616294 587604 ~ 588015 (-)
G69150 NA other downstream 637353 565463 ~ 566956 (-)
G69562 NA other upstream 127536 1332075 ~ 1376298 (-)
G70774 NA other upstream 1661969 2866508 ~ 2866892 (-)
G71898 NA other upstream 3328991 4533530 ~ 4534672 (-)
G72068 NA other upstream 3571681 4776220 ~ 4780132 (-)
G72204 NA other upstream 4089234 5293773 ~ 5302206 (-)

Expression



Co-expression Network