LOC103045184


Basic Information

Item Value
gene id LOC103045184
gene name NA
gene type coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 27464039 ~ 27464863 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>XR_002651480.1
TTGCAGTTATTTCCACCTTGCCTGTTTGCATCATTTTAATTTGCATCTGCAGAAAGGGTTCCTGTAGAAGAGATTCACCTAACAGAAGAAAAGGTAAT

Function

GO: NA

KEGG:

id description
ko00520 Amino sugar and nucleotide sugar metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
XR_002651480.1 True 98 ncRNA 0.38 2 27464039 27464863

Neighbor

gene id symbol gene type direction distance location
tmem126a NA coding downstream 472406 26988617 ~ 26991633 (-)
LOC103028079 arrb2,LOC100335038,LOC106567894,LOC105023937,LOC101076921 coding downstream 524116 26927169 ~ 26939923 (-)
med11 med11,LOC107720680,LOC107676028 coding downstream 544196 26916334 ~ 26919843 (-)
LOC103027750 zgc:103508,cssa04h17orf49,LOC108424543,LOC107720679,LOC107742347,LOC107702799 coding downstream 551216 26909211 ~ 26912823 (-)
LOC103023750 LOC108424450 coding downstream 638183 26822739 ~ 26825856 (-)
vps11 vps11,LOC107691631,LOC107744603 coding upstream 15796 27480659 ~ 27493366 (-)
LOC103027279 NA coding upstream 46268 27511131 ~ 27518562 (-)
zpr1 zpr1,LOC107693980,LOC107747003,LOC107751399,LOC107577081 coding upstream 63797 27528660 ~ 27539710 (-)
bsx bsx,LOC107747047 coding upstream 126708 27591571 ~ 27594524 (-)
LOC103041089 lim2.1,LOC103041089,LOC108423752,LOC107579014 coding upstream 135229 27600092 ~ 27606283 (-)
G179528 NA non-coding downstream 448073 27015745 ~ 27015966 (-)
G179524 NA non-coding downstream 453221 27010524 ~ 27010818 (-)
G179490 NA non-coding downstream 574954 26884446 ~ 26889085 (-)
G179487 LOC108424537 non-coding downstream 584616 26877576 ~ 26879423 (-)
G179475 NA non-coding downstream 589476 26872578 ~ 26874563 (-)
G179572 hyou1,LOC107588517 non-coding upstream 40832 27505695 ~ 27507977 (-)
G179596 NA non-coding upstream 198124 27662987 ~ 27663294 (-)
G179597 NA non-coding upstream 201896 27666759 ~ 27667611 (-)
G179642 NA non-coding upstream 223263 27688126 ~ 27691388 (-)
G179651 NA non-coding upstream 447967 27912830 ~ 27964374 (-)
G179569 NA other downstream 20723 27440231 ~ 27443316 (-)
LOC103047293 LOC108410718,LOC106581537 other downstream 1599565 25656255 ~ 25864474 (-)
LOC103043022 LOC108410630,LOC107556853 other downstream 1991795 25363932 ~ 25472244 (-)
thsd1 thsd1 other downstream 2160956 25293675 ~ 25303083 (-)
LOC103025094 zgc:171929,LOC107690845,LOC107575147,LOC107671611,LOC105905449 other downstream 2256653 25203325 ~ 25207386 (-)
ift46 ift46 other upstream 5223 27470086 ~ 27477978 (-)
LOC103038646 zgc:194989,hist2h2l,LOC107719244,LOC107667924,LOC107574861,LOC108277172,LOC105900366,LOC103356012 other upstream 58268 27523131 ~ 27524135 (-)
G179583 zgc:101846,LOC106525086,LOC108416226,LOC101161532 other upstream 59465 27524328 ~ 27525388 (-)
G179578 LOC108423781,LOC107751398,LOC107693988,LOC107577128,LOC107691633,LOC107588586 other upstream 96982 27561845 ~ 27566692 (-)
G179816 NA other upstream 1385827 28850690 ~ 28851105 (-)

Expression


Co-expression Network