G69800


Basic Information

Item Value
gene id G69800
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 1861651 ~ 1861988 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU79593
ATAGTCAAACAGGCGTGGGTCAAGTAAACAGGAAATATCAACGGTCAAAATACTACAGTCACACTCACAGATACAAACTCCGAATAATCACTCACAATCAATCTCTCTGGCACGACACTCTAGACTAACAAACGATACGAAGTAATGATGAGATACGATCAAAGACACGATGGCACAATGATGGCCCCTTCAGTGTGTTCGGGGCGGTCTTTATATCTGGATCAGGTGAGGAGGAGAACCAATTGCAGCCTCCAACAGGTTATCACAAGTCACCGCCCATCTGTAATACAAACATGCATAGGCACACACACACAGAGAAAATACACAAGATAAACACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU79593 True 338 lncRNA 0.43 1 1861651 1861988

Neighbor

gene id symbol gene type direction distance location
CI01000012_01677949_01691893 POLR1B coding downstream 169615 1677904 ~ 1692036 (-)
CI01000012_01601665_01604244 CYP1B1 coding downstream 257298 1601654 ~ 1604353 (-)
CI01000012_01489297_01490202 CDC42EP3 coding downstream 371338 1488830 ~ 1490313 (-)
CI01000012_01256938_01257273 PRKCE coding downstream 604378 1255717 ~ 1257273 (-)
CI01000012_01240945_01242653 SOCS5, SOCS5B coding downstream 618998 1240517 ~ 1242653 (-)
CI01000012_02239088_02240850 NA coding upstream 376412 2238400 ~ 2240862 (-)
CI01000012_02251322_02337964 PRKG1A, PRKG1, PRKG1B coding upstream 389149 2251137 ~ 2339368 (-)
CI01000012_02357517_02361973 NKX1-2, NKX1.2LA coding upstream 495136 2357124 ~ 2361973 (-)
CI01000012_02381631_02386668 NA coding upstream 519360 2381348 ~ 2386668 (-)
CI01000012_02395816_02404347 HPS1 coding upstream 533569 2395557 ~ 2404347 (-)
G69781 NA non-coding downstream 32427 1828995 ~ 1829224 (-)
G69779 NA non-coding downstream 43163 1818033 ~ 1818488 (-)
G69778 NA non-coding downstream 44345 1817022 ~ 1817306 (-)
G69777 NA non-coding downstream 51522 1809924 ~ 1810129 (-)
G69759 NA non-coding downstream 67388 1794031 ~ 1794263 (-)
G70439 NA non-coding upstream 165559 2027547 ~ 2035108 (-)
G70462 NA non-coding upstream 218536 2080524 ~ 2082217 (-)
G70469 NA non-coding upstream 230882 2092870 ~ 2095569 (-)
G70477 NA non-coding upstream 253243 2115231 ~ 2115727 (-)
G70522 NA non-coding upstream 310951 2172939 ~ 2173220 (-)
G69562 NA other downstream 485353 1332075 ~ 1376298 (-)
CI01000012_01139864_01192154 TTC7A other downstream 710453 1135676 ~ 1192154 (-)
G69332 NA other downstream 1085772 775364 ~ 775879 (-)
G69277 NA other downstream 1131186 729920 ~ 730465 (-)
G69161 NA other downstream 1273636 587604 ~ 588015 (-)
G70774 NA other upstream 1004520 2866508 ~ 2866892 (-)
G71898 NA other upstream 2671542 4533530 ~ 4534672 (-)
G72068 NA other upstream 2914232 4776220 ~ 4780132 (-)
G72204 NA other upstream 3431785 5293773 ~ 5302206 (-)
CI01000012_05414096_05416676 TTC9 other upstream 3501654 5413369 ~ 5416780 (-)

Expression


Co-expression Network