G71770


Basic Information

Item Value
gene id G71770
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 3748001 ~ 3748207 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU81810
CTCTTCTGTGTCATTCTCTTATGCTGTCTACATTCAACGCTTCCAGGTTTGACATCAGAAGGCCGGCTAATTATTGGCCGGTGCTGTTCATGTGAGCAGCACAATGCATGCATGTGATGCTGACCCAGGAGCCGGCCAATACGGAGTCGGCGTTCAGACGTAGAACCTGGAAGCGATGGACGTAAACAACTGAACGTGACACAGAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU81810 True 207 lncRNA 0.50 1 3748001 3748207

Neighbor

gene id symbol gene type direction distance location
CI01000012_03729351_03731119 NA coding downstream 15536 3729175 ~ 3732465 (-)
CI01000012_03717828_03724221 NA coding downstream 22257 3717460 ~ 3725744 (-)
CI01000012_03595690_03618511 NA coding downstream 129490 3595532 ~ 3618511 (-)
CI01000012_03437950_03468790 NA coding downstream 279148 3437789 ~ 3468853 (-)
CI01000012_03357081_03369647 FAM135A coding downstream 378354 3357081 ~ 3369647 (-)
CI01000012_03771803_03792867 ADGRB3 coding upstream 22971 3771178 ~ 3793190 (-)
CI01000012_03794143_03871728 NA coding upstream 45743 3793143 ~ 3873248 (-)
CI01000012_03875714_03882574 NA coding upstream 126875 3875082 ~ 3882574 (-)
CI01000012_03963989_03965578 NA coding upstream 214966 3963173 ~ 3965740 (-)
CI01000012_04048205_04049218 NA coding upstream 297946 4046153 ~ 4049506 (-)
G71768 NA non-coding downstream 2776 3744918 ~ 3745225 (-)
G71767 NA non-coding downstream 3415 3744322 ~ 3744586 (-)
G71699 NA non-coding downstream 4902 3723127 ~ 3743099 (-)
G71717 NA non-coding downstream 84911 3662623 ~ 3663090 (-)
G70813 NA non-coding downstream 202961 3530609 ~ 3545040 (-)
G71771 NA non-coding upstream 241 3748448 ~ 3748697 (-)
G71772 NA non-coding upstream 1361 3749568 ~ 3750028 (-)
G71773 NA non-coding upstream 3912 3752119 ~ 3752407 (-)
G71774 NA non-coding upstream 7613 3755820 ~ 3756095 (-)
G71780 NA non-coding upstream 15605 3763812 ~ 3764032 (-)
G70774 NA other downstream 881109 2866508 ~ 2866892 (-)
G69562 NA other downstream 2371703 1332075 ~ 1376298 (-)
CI01000012_01139864_01192154 TTC7A other downstream 2596803 1135676 ~ 1192154 (-)
G69332 NA other downstream 2972122 775364 ~ 775879 (-)
G69277 NA other downstream 3017536 729920 ~ 730465 (-)
G71898 NA other upstream 785323 4533530 ~ 4534672 (-)
G72068 NA other upstream 1028013 4776220 ~ 4780132 (-)
G72204 NA other upstream 1545566 5293773 ~ 5302206 (-)
CI01000012_05414096_05416676 TTC9 other upstream 1615435 5413369 ~ 5416780 (-)
G72294 NA other upstream 1714633 5462840 ~ 5465857 (-)

Expression


Co-expression Network