G71152


Basic Information

Item Value
gene id G71152
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 4087869 ~ 4088242 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU81121
GAAAGTAATCACTGTGGTAGTGCTCTGGGTTGCATTTCCCAAAAGCATTGTAAGCCTATGTTGATTGTAAAACCATTGCCACCAATAGACTTATGATCAATTTAGGCTTTACAATGTTTTTGGTTAAGGCAATTTAGGATGAATCCAGTATCACATCTAGATTTCTAACATAGAACATCACAAAAGTTATATAAATCACAAAATTAAACAAGAAGAATTAATTGTAAAAATCAATGTATATGAAAACAATTTATTTATTGCTTTTTATTTATTTTCCAAAACATTGCAAATTAGTTGGGCTGACACTATTAAATTAAGCTGTGCCCAACCATAGTAAATAAGTTGAATCAACCTTAATAAATTAAGTTGACCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU81121 True 374 lncRNA 0.30 1 4087869 4088242

Neighbor

gene id symbol gene type direction distance location
CI01000012_03989870_04006406 NA coding upstream 81274 3989711 ~ 4006595 (+)
CI01000012_03736684_03742335 LMBRD1 coding upstream 344803 3736636 ~ 3743066 (+)
CI01000012_03633636_03709136 LMBRD1 coding upstream 378733 3633636 ~ 3709136 (+)
CI01000012_03414617_03418724 NA coding upstream 668461 3414617 ~ 3419408 (+)
CI01000012_03394096_03396897 NA coding upstream 690972 3393889 ~ 3396897 (+)
CI01000012_04179776_04184166 NA coding downstream 91534 4179776 ~ 4184450 (+)
CI01000012_04209791_04237026 NA coding downstream 120784 4209026 ~ 4237160 (+)
CI01000012_04266133_04266370 NA coding downstream 177891 4266133 ~ 4267426 (+)
CI01000012_04285964_04292319 NA coding downstream 197352 4285594 ~ 4293775 (+)
CI01000012_04371425_04373907 NA coding downstream 283183 4371425 ~ 4373991 (+)
G71145 NA non-coding upstream 20036 4067613 ~ 4067833 (+)
CI01000012_04052923_04100797 NA non-coding upstream 33869 4052613 ~ 4101000 (+)
G71134 NA non-coding upstream 43634 4042982 ~ 4044235 (+)
G71124 NA non-coding upstream 67563 4019905 ~ 4020306 (+)
G71038 NA non-coding upstream 122301 3825833 ~ 3965568 (+)
G71156 NA non-coding downstream 18593 4106835 ~ 4107122 (+)
G71158 NA non-coding downstream 21699 4109941 ~ 4110276 (+)
G71305 NA non-coding downstream 150883 4239125 ~ 4239406 (+)
G71375 NA non-coding downstream 258562 4346804 ~ 4347380 (+)
G71238 NA non-coding downstream 393396 4481638 ~ 4505484 (+)
G70029 NA other upstream 1456484 2622478 ~ 2631385 (+)
G68725 NA other upstream 3403013 683523 ~ 684856 (+)
G68660 NA other upstream 3551916 535566 ~ 535953 (+)
CI01000012_00194370_00195347 HCAR1-3 other upstream 3882095 193903 ~ 195676 (+)
CI01000012_04424569_04425090 NA other downstream 331997 4424569 ~ 4425756 (+)
CI01000012_04495631_04501066 NA other downstream 410211 4495631 ~ 4501066 (+)
CI01000012_05177587_05180517 SRSF5A other downstream 1088653 5176895 ~ 5180970 (+)
G71199 NA other downstream 1325008 5413250 ~ 5416785 (+)
G71218 NA other downstream 1447610 5535852 ~ 5538384 (+)

Expression


Co-expression Network