G187584


Basic Information

Item Value
gene id G187584
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035918.1
NCBI id CM008321.1
chromosome length 32506130
location 5888833 ~ 5899725 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU254362
ttgatgtttaatttcatgatgtctcttaatattaaactccttaattacggcaacttttagactctttggcccgtttttctgcgctagaaatgtgaactctctccgcttttagactctttggcccgtttttctgcgctagaaatgcgcactctctccgcttttagactctttggcccgattttctgcgctagaaatgcgcaccctctccgcttttagactctttggcccgattttctgcgctagaaatgcgcactctctccgcttttagactctttgccccgtttttctgcactagaaatgcgcactctctccgcttttagactctttgccccgt

Function

GO: NA

KEGG:

id description
ko00830 Retinol metabolism
ko00980 Metabolism of xenobiotics by cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA

RNA id representative length rna type GC content exon number start site end site
TU254362 True 334 lncRNA 0.46 3 5888833 5899725

Neighbor

gene id symbol gene type direction distance location
cldn19 cldn19,LOC107654447,LOC107582397,LOC107751184,LOC107565733 coding upstream 53207 5817984 ~ 5835626 (+)
ap5b1 ap5b1 coding upstream 117536 5765449 ~ 5771297 (+)
wnt4 wnt4,wnt4a,LOC107565731,LOC107654388 coding upstream 157489 5725343 ~ 5731344 (+)
fbxo2 NA coding upstream 371268 5508308 ~ 5517565 (+)
LOC103021734 dnajc11,LOC107654442,LOC107751176,LOC103038967 coding upstream 402420 5472482 ~ 5486413 (+)
LOC111195362 NA coding downstream 246960 6146685 ~ 6147519 (+)
LOC103043936 nucks1,nucks1a,LOC108255091,LOC107654381 coding downstream 342302 6242027 ~ 6258457 (+)
LOC103043630 LOC108437608 coding downstream 377074 6276799 ~ 6288068 (+)
LOC103043323 LOC108437607 coding downstream 392075 6291800 ~ 6298905 (+)
elk4 elk4,LOC108437624 coding downstream 406069 6305794 ~ 6325915 (+)
G187583 NA non-coding upstream 2831 5885802 ~ 5886002 (+)
G187493 NA non-coding upstream 45003 5759517 ~ 5843830 (+)
G187487 cdc42,LOC107083933,LOC100697482,LOC107395067,LOC103386293,LOC108435227,LOC105931589 non-coding upstream 125342 5701793 ~ 5763491 (+)
G187484 NA non-coding upstream 247777 5640822 ~ 5641056 (+)
G187477 NA non-coding upstream 386957 5499104 ~ 5501876 (+)
G187610 NA non-coding downstream 205467 6105192 ~ 6178630 (+)
G187640 NA non-coding downstream 401127 6300852 ~ 6302749 (+)
G187645 NA non-coding downstream 403041 6302766 ~ 6304222 (+)
G187637 NA non-coding downstream 418089 6317814 ~ 6334469 (+)
G187647 NA non-coding downstream 437387 6337112 ~ 6340403 (+)
p3h1 NA other upstream 89854 5779891 ~ 5798979 (+)
G186978 rps23,rs23,LOC106566095,LOC106566598 other upstream 2493990 3392387 ~ 3394843 (+)
G186880 lmcd1 other upstream 2886818 2980497 ~ 3002015 (+)
podxl2 NA other upstream 4793496 606833 ~ 1095337 (+)
cers5 cers5,LOC107698577,LOC107590873,LOC107694004,LOC107718462 other upstream 5350617 510575 ~ 538216 (+)
LOC103029365 NA other downstream 1177440 7077165 ~ 7098672 (+)
trnaq-uug_4 NA other downstream 1292429 7192154 ~ 7192226 (+)
LOC111195452 NA other downstream 2212278 8112003 ~ 8113242 (+)
agtrap agtrap other downstream 2357071 8256796 ~ 8271712 (+)
LOC103032765 igsf21,igsf21a,LOC108438574,LOC107749415,LOC107727841,LOC107685626 other downstream 3384070 9283795 ~ 9819955 (+)

Expression


Co-expression Network