G71239


Basic Information

Item Value
gene id G71239
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 4529356 ~ 4585221 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU81219
TGCAAAATTTTCTTTTATCTGAAAAGAGGACTTTCGGCCACTGTTCACTGTCCAGTTCTTTTTCTCCTTAGCCCAGGTAAGATGCTTCTGACGTTGTCTCTGGTTCAGAAGTGGCTTGGTAGTCCTTTTCCTGAAGATGTCTGAGTGTGGTGACTCTTGATGCGCTGACTCCGGCTTCATTCTACTCATTGTGAAGCTCTCCCAAGTGTTTGAATCGGCTTTACTTGACAGTATTCTCAAGCTTGCGGTCATCCCTGTTGCTTGTGCACCTTTGCCTACCCAATTTCTTCCTTCGAGTCAACTTTGCATTTAATATGCTTTGATACATCACTCTGTAAACAGCCACCCCATTCAGTAATGACCTTCTGTGACTTACTCTCTTTGTGGAGGGTGTCAATGATTGTCTCCTGGACCATTGCCAAGTCAGCAGTCTTCCCCATTAGTGTGGTTTCAAAGAACAAAAGATACCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU81219 True 470 lncRNA 0.44 2 4529356 4585221

Neighbor

gene id symbol gene type direction distance location
CI01000012_04495631_04501066 NA coding upstream 28290 4495631 ~ 4501066 (+)
CI01000012_04488201_04489863 NA coding upstream 39459 4488201 ~ 4489897 (+)
CI01000012_04436374_04437448 NA coding upstream 91757 4435280 ~ 4437599 (+)
CI01000012_04424569_04425090 NA coding upstream 103600 4424569 ~ 4425756 (+)
CI01000012_04386557_04402516 NA coding upstream 126381 4386203 ~ 4402975 (+)
CI01000012_04595199_04620295 PPP2R5EB, 2A5E, PPP2R5E1, PPP2R5E coding downstream 8646 4593867 ~ 4620453 (+)
CI01000012_04647182_04692241 KCNH5, KCNH5B coding downstream 61961 4647182 ~ 4692476 (+)
CI01000012_04722087_04836261 NA coding downstream 136866 4722087 ~ 4837574 (+)
CI01000012_04939174_04962741 TRIM9 coding downstream 352925 4938146 ~ 4962741 (+)
CI01000012_04966772_04976751 PYGL coding downstream 381494 4966715 ~ 4976903 (+)
G71238 NA non-coding upstream 23872 4481638 ~ 4505484 (+)
G71375 NA non-coding upstream 181976 4346804 ~ 4347380 (+)
G71305 NA non-coding upstream 289950 4239125 ~ 4239406 (+)
G71158 NA non-coding upstream 419080 4109941 ~ 4110276 (+)
G71156 NA non-coding upstream 422234 4106835 ~ 4107122 (+)
G71442 NA non-coding downstream 56316 4641537 ~ 4641848 (+)
G71208 NA non-coding downstream 121335 4706556 ~ 4710923 (+)
G71478 NA non-coding downstream 205435 4790656 ~ 4790866 (+)
G71237 NA non-coding downstream 207317 4792538 ~ 4850513 (+)
G71488 NA non-coding downstream 285367 4870588 ~ 4870819 (+)
G70029 NA other upstream 1897971 2622478 ~ 2631385 (+)
G68725 NA other upstream 3844500 683523 ~ 684856 (+)
CI01000012_05177587_05180517 SRSF5A other downstream 591674 5176895 ~ 5180970 (+)
G71199 NA other downstream 828029 5413250 ~ 5416785 (+)
G71218 NA other downstream 950631 5535852 ~ 5538384 (+)
G71221 NA other downstream 953304 5538525 ~ 5540456 (+)
G71548 NA other downstream 965272 5550493 ~ 5561433 (+)

Expression


Co-expression Network