G72065


Basic Information

Item Value
gene id G72065
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 4767819 ~ 4770083 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU82184
CGGGACACCGAGGGGCGGGGCAGATATATCCTGCACCTCAATTGAGTATTCTAGAGCCAGCTGCTCTAGTTCCAGCAGCTGTTTCTGTAGTACTTCTGCTCTTTTAAACACTAGGAGTGTGTTTTCAGAGTTGTCAGGAAGACACAGACCATCCTTACAGTTCTGGATCTCAGCTACTGTCCTTTTCATCAGGTCAATCCTGTCTTCTGTTGCCTTAAGATTGTCTTGGCTGATGTCTTCTTTGGTAGTCAGAGTACATTTAATTTTGGCTACATCTTTCTCCATGACCTTCACCTCTGACTCAATGGCATCCACTTCTGCTGCTGCGTGCTCCAGCTGAGAGAGGGGTCCCAGCAGGCTGTGCTGCATGTCTGCCACACGTCGATCAGCATTTGAGAGCTGCTCCTCTAAAGGACTGACATCAAACACACTTCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU82184 True 436 lncRNA 0.49 4 4767819 4770083

Neighbor

gene id symbol gene type direction distance location
CI01000012_04706769_04709074 GPHB5 coding downstream 58745 4706701 ~ 4709074 (-)
CI01000012_04404769_04419096 PHF3 coding downstream 348723 4404326 ~ 4419096 (-)
CI01000012_04375448_04378813 NA coding downstream 388415 4375358 ~ 4379404 (-)
CI01000012_04048205_04049218 NA coding downstream 718313 4046153 ~ 4049506 (-)
CI01000012_03963989_03965578 NA coding downstream 802079 3963173 ~ 3965740 (-)
CI01000012_04839741_04854323 NA coding upstream 69392 4839475 ~ 4854999 (-)
CI01000012_04879477_04890031 FRMD6 coding upstream 109357 4879440 ~ 4890031 (-)
CI01000012_04926292_04930302 TMX1 coding upstream 155413 4925496 ~ 4930474 (-)
CI01000012_05022143_05030697 ATL1 coding upstream 251660 5021743 ~ 5030697 (-)
CI01000012_05079456_05083333 ATP5S coding upstream 309164 5079247 ~ 5083333 (-)
G72060 NA non-coding downstream 38 4757073 ~ 4767781 (-)
G72055 NA non-coding downstream 20631 4746444 ~ 4747188 (-)
G72054 NA non-coding downstream 21943 4734337 ~ 4745876 (-)
G72021 NA non-coding downstream 128993 4638501 ~ 4638826 (-)
G72019 NA non-coding downstream 136028 4631495 ~ 4631791 (-)
G72071 NA non-coding upstream 20051 4790134 ~ 4790584 (-)
G72072 NA non-coding upstream 21312 4791395 ~ 4797561 (-)
G72130 NA non-coding upstream 100121 4870204 ~ 4870468 (-)
G72089 NA non-coding upstream 106320 4876403 ~ 4878411 (-)
G72135 NA non-coding upstream 136815 4906898 ~ 4907339 (-)
G71898 NA other downstream 233147 4533530 ~ 4534672 (-)
G70774 NA other downstream 1900927 2866508 ~ 2866892 (-)
G69562 NA other downstream 3391521 1332075 ~ 1376298 (-)
CI01000012_01139864_01192154 TTC7A other downstream 3616621 1135676 ~ 1192154 (-)
G69332 NA other downstream 3991940 775364 ~ 775879 (-)
G72068 NA other upstream 6137 4776220 ~ 4780132 (-)
G72204 NA other upstream 523690 5293773 ~ 5302206 (-)
CI01000012_05414096_05416676 TTC9 other upstream 593559 5413369 ~ 5416780 (-)
G72294 NA other upstream 692757 5462840 ~ 5465857 (-)
G72629 NA other upstream 1376928 6147011 ~ 6147494 (-)

Expression


Co-expression Network