G189054


Basic Information

Item Value
gene id G189054
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035918.1
NCBI id CM008321.1
chromosome length 32506130
location 12040575 ~ 12040855 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU256228
gcgatatatttctcctttgacgtcgcaaaaaacaagataacgtgtaaaccgtgtggagcgactccatctccggtaaaaacaccactaatctttcagcttctgcagaccagagtcacacagatctccatgcagagatcagcgttttaatactgatgttatttcatgagctgatgtgtttaactcggcagtgcactaaaacacagaactgatacagaactcactcgttaagatcagatcatctgtttagtctcacagtgggaaagatatagctagtgttaaag

Function

GO: NA

KEGG:

id description
ko00830 Retinol metabolism
ko00980 Metabolism of xenobiotics by cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA

RNA id representative length rna type GC content exon number start site end site
TU256228 True 281 lncRNA 0.41 1 12040575 12040855

Neighbor

gene id symbol gene type direction distance location
suclg2 suclg2,LOC107729402,LOC107753779,LOC107699794 coding downstream 506160 11372257 ~ 11534415 (-)
lrig1 lrig1,LOC107716980,LOC107557776 coding downstream 884830 11080123 ~ 11155745 (-)
LOC111195430 gria2,LOC108411138 coding downstream 1180677 10834016 ~ 10859898 (-)
lrrc38 lrrc38,LOC108439497,LOC107685631,LOC108281009,LOC107691331,LOC107555684,LOC107568719 coding downstream 1756661 10224975 ~ 10283914 (-)
LOC111195372 LOC108410896,LOC108414677,LOC108416243 coding downstream 1937682 10094323 ~ 10102893 (-)
fam19a4 fam19a4,fam19a4b,LOC107655986,LOC107600333,LOC107729393,LOC107696804,LOC107558879 coding upstream 16677 12057532 ~ 12115859 (-)
tmf1 tmf1 coding upstream 141264 12182119 ~ 12207582 (-)
hmces hmces coding upstream 189561 12230416 ~ 12236146 (-)
tada3 tada3,tada3l,LOC107656064,LOC106565817 coding upstream 196031 12236886 ~ 12244320 (-)
LOC103042309 LOC108435436,LOC108254777,LOC107677511,LOC104938990,LOC107574463,LOC107715804,LOC107551799 coding upstream 217939 12258794 ~ 12289011 (-)
G189053 NA non-coding downstream 1487 12038777 ~ 12039088 (-)
G189052 NA non-coding downstream 31517 12008843 ~ 12009058 (-)
LOC111195377 NA non-coding downstream 283466 11755397 ~ 11757109 (-)
G188994 NA non-coding downstream 580198 11460088 ~ 11460377 (-)
G188985 NA non-coding downstream 735122 11302749 ~ 11305453 (-)
G189085 rab7a,LOC107093905,LOC101061812,LOC106582926,LOC106518505 non-coding upstream 180435 12221290 ~ 12229525 (-)
G189159 NA non-coding upstream 286903 12327758 ~ 12328365 (-)
G189315 NA non-coding upstream 475086 12515941 ~ 12518663 (-)
G189316 NA non-coding upstream 487715 12528570 ~ 12528851 (-)
G189317 usp48 non-coding upstream 488289 12529144 ~ 12533333 (-)
G188898 NA other downstream 1049181 10990817 ~ 10991394 (-)
LOC111195437 NA other downstream 2084258 9951084 ~ 9956317 (-)
ghrh ghrh,LOC103034597,LOC108438619 other downstream 4620769 7409122 ~ 7419806 (-)
G187946 mybl2,mybl2b other downstream 4649549 7388397 ~ 7391026 (-)
pdrg1 pdrg1 other downstream 4847323 7188616 ~ 7193252 (-)
G189055 NA other upstream 3058 12043913 ~ 12044293 (-)
eogt eogt,LOC107729408 other upstream 119687 12160542 ~ 12178610 (-)
mapkapk3 mapkapk3,LOC102784126,LOC107384936,LOC101473327,LOC102305022,LOC102199310,LOC106525176 other upstream 257194 12298049 ~ 12395532 (-)
LOC111195455 NA other upstream 571756 12612611 ~ 12714032 (-)
G189335 psma5,LOC107685984 other upstream 574057 12614912 ~ 12619566 (-)

Expression


Co-expression Network