G71478


Basic Information

Item Value
gene id G71478
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 4790656 ~ 4790866 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU81460
CTAACTGTTCCCTGAGCGGTTGGAAAGAAATGCCAGTCAGTTTCAAGTTCTTTATTTTGGAGCATTGTCTCCCTGAAGGAGAACATTAGGTTTAAATTTTTCTCATGAAGGTCATGCAGCCATGATTTCCTGTATCTCTCAGCAGCTAATGAAATCTGTGAGGAATAGAGTCTCTGTCCTTTCTTCATCCATTAGGATGCTCTCTTTCTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU81460 True 211 lncRNA 0.41 1 4790656 4790866

Neighbor

gene id symbol gene type direction distance location
CI01000012_04647182_04692241 KCNH5, KCNH5B coding upstream 98180 4647182 ~ 4692476 (+)
CI01000012_04595199_04620295 PPP2R5EB, 2A5E, PPP2R5E1, PPP2R5E coding upstream 170203 4593867 ~ 4620453 (+)
CI01000012_04578508_04582452 WDR89 coding upstream 208046 4576995 ~ 4582610 (+)
CI01000012_04551570_04571150 SGPP1 coding upstream 219317 4551169 ~ 4571339 (+)
CI01000012_04514814_04539220 SYT16 coding upstream 251057 4514814 ~ 4539599 (+)
CI01000012_04939174_04962741 TRIM9 coding downstream 147280 4938146 ~ 4962741 (+)
CI01000012_04966772_04976751 PYGL coding downstream 175849 4966715 ~ 4976903 (+)
CI01000012_04981435_05004449 NIN coding downstream 190569 4981435 ~ 5005112 (+)
CI01000012_05006941_05018373 SAV1 coding downstream 216075 5006941 ~ 5018880 (+)
CI01000012_05035890_05063488 MAP4K5 coding downstream 244660 5035526 ~ 5064475 (+)
G71208 NA non-coding upstream 79733 4706556 ~ 4710923 (+)
G71442 NA non-coding upstream 148808 4641537 ~ 4641848 (+)
G71239 NA non-coding upstream 205435 4529356 ~ 4585221 (+)
G71238 NA non-coding upstream 285172 4481638 ~ 4505484 (+)
G71237 NA non-coding downstream 1672 4792538 ~ 4850513 (+)
G71488 NA non-coding downstream 79722 4870588 ~ 4870819 (+)
G71490 NA non-coding downstream 84159 4875025 ~ 4875314 (+)
G71198 NA non-coding downstream 85539 4876405 ~ 4878412 (+)
G71491 NA non-coding downstream 87752 4878618 ~ 4878844 (+)
CI01000012_04495631_04501066 NA other upstream 290567 4495631 ~ 4501066 (+)
CI01000012_04424569_04425090 NA other upstream 365009 4424569 ~ 4425756 (+)
G70029 NA other upstream 2159271 2622478 ~ 2631385 (+)
G68725 NA other upstream 4105800 683523 ~ 684856 (+)
CI01000012_05177587_05180517 SRSF5A other downstream 386029 5176895 ~ 5180970 (+)
G71199 NA other downstream 622384 5413250 ~ 5416785 (+)
G71218 NA other downstream 744986 5535852 ~ 5538384 (+)
G71221 NA other downstream 747659 5538525 ~ 5540456 (+)
G71548 NA other downstream 759627 5550493 ~ 5561433 (+)

Expression


Co-expression Network