G192955 (tfeb)


Basic Information

Item Value
gene id G192955
gene name tfeb
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035918.1
NCBI id CM008321.1
chromosome length 32506130
location 25854665 ~ 25858416 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU261833
ACCGTGTTTGGCATCACAGGGTCAACGTAATTCTGTATGTCATCATAGCTCGACTGCATGCTGATGATGTCGTCGATAACATCCTCCACCTCTTTCTCGTGGCTGCCGCTGATGTTCAGCATGGCCATTGGGCTGTTGGGGGCGCTGTTCCCCGCTGAGTTCATGAGCTGCTCAGTGCGCATGTGTGGCGAGGGCAGGGGAGGCGGGGCACCAGCAGACTGCACCTGGGCCATGTTGGGCGGAGAGGGGTGGACCACGCCCGCTACAGCGTGCACTGCCTGCTTGGTGGCGTAGGTGGTGGAGAGGTACTCCTTGACCTGCTGGCGCTGGGACTGGCGGATGTGGTAGTCCGTGGGGTTCTCCAGGTGAGTCTGT

Function

symbol description
tfeb Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within central nervous system myelination. Predicted to be active in nucleus. Is expressed in several structures, including head; immature eye; mesoderm; pancreatic system; and pronephros. Orthologous to human TFEB (transcription factor EB).

NR:

description
PREDICTED: transcription factor EB isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU261833 True 375 lncRNA 0.61 2 25854665 25858416

Neighbor

gene id symbol gene type direction distance location
ppfia4 ppfia4 coding downstream 83946 25587726 ~ 25770719 (-)
LOC103039085 NA coding downstream 299978 25508488 ~ 25554687 (-)
LOC103038137 NA coding downstream 317662 25527642 ~ 25537003 (-)
lrrn2 lrrn2,LOC108425772,LOC107603068,LOC107739267,LOC107727852,LOC107675837,LOC107656005 coding downstream 500188 25235114 ~ 25354477 (-)
LOC103045744 NA coding downstream 1053764 24774039 ~ 24800901 (-)
LOC103036054 mdfi,LOC103036054,LOC107548515,LOC107675846,LOC107728619 coding upstream 150380 26008796 ~ 26085478 (-)
LOC103035733 foxp4,LOC107739274,LOC107728618 coding upstream 256021 26114437 ~ 26349705 (-)
il10 NA coding upstream 1270736 27129152 ~ 27133856 (-)
LOC103047370 NA coding upstream 1289298 27147714 ~ 27153326 (-)
prelp prelp coding upstream 1304331 27162747 ~ 27170995 (-)
G192952 NA non-coding downstream 28709 25819208 ~ 25825956 (-)
G192951 NA non-coding downstream 35714 25809068 ~ 25818951 (-)
G192947 NA non-coding downstream 69210 25782382 ~ 25785455 (-)
G192944 tmem183a,LOC107656009,LOC107727871,LOC107739272 non-coding downstream 75471 25775397 ~ 25779194 (-)
G192892 NA non-coding downstream 274356 25578863 ~ 25580309 (-)
G193005 NA non-coding upstream 369192 26227608 ~ 26297229 (-)
G193014 NA non-coding upstream 576092 26434508 ~ 26434782 (-)
G193017 NA non-coding upstream 634787 26493203 ~ 26493562 (-)
G193018 NA non-coding upstream 719316 26577732 ~ 26577984 (-)
G193020 NA non-coding upstream 760330 26618746 ~ 26618978 (-)
G192815 mdm4 other downstream 637115 25211675 ~ 25217550 (-)
cntn2 cntn2,LOC107727196,LOC107558367,LOC107727774,LOC107602860,LOC106565094 other downstream 1748767 24039246 ~ 24105898 (-)
G192251 adipor1,LOC107749488,LOC107385668 other downstream 2795860 23054633 ~ 23058805 (-)
LOC103041653 phf20,LOC107655063,LOC107727854,LOC107561906 other downstream 3051023 22786163 ~ 22803642 (-)
amhr2 NA other downstream 3131760 22709549 ~ 22722905 (-)
LOC111195415 tfeb other upstream 16494 25874910 ~ 25878653 (-)
fam72a fam72a,zgc:101564,LOC108425783,LOC107590148,LOC107656018,LOC107548849,LOC107675824 other upstream 852837 26711253 ~ 26724106 (-)
G193097 NA other upstream 1173247 27031663 ~ 27033089 (-)
LOC111195340 NA other upstream 1532378 27390794 ~ 27391571 (-)
LOC103046149 LOC102777140,LOC108436414,LOC102208887,LOC105027122,LOC108280970,LOC103144351,LOC107751002 other upstream 1566626 27425042 ~ 27701331 (-)

Expression


Co-expression Network