G72484


Basic Information

Item Value
gene id G72484
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 6027694 ~ 6027911 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU82682
ACCTGTTGAATGTTGCAACCGAAAACACCTGCTGATTGTTAAAGGGTTAGTTCACCCAAAAATGAAAATTCTGTCATTAAATACTCACCCTCATGTCATTCCAAACCTGTAAGGATTTCGTTCATCTTCGGAACACAAATGAAGATCTTTTTAATGAAATCTGCGAGCTTTCTGTCCCTCCATTGACAGCCTACGCAACTACCTCTTTCAAGCCCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU82682 True 218 lncRNA 0.41 1 6027694 6027911

Neighbor

gene id symbol gene type direction distance location
CI01000012_05946986_05984551 SLX4IP coding upstream 41735 5946986 ~ 5985959 (+)
CI01000012_05923216_05928055 SRD5A2B coding upstream 98508 5922385 ~ 5929186 (+)
CI01000012_05909453_05916000 MEMO1 coding upstream 111520 5909453 ~ 5916174 (+)
CI01000012_05856793_05862577 NA coding upstream 165052 5856316 ~ 5862642 (+)
CI01000012_05748899_05754466 ERLEC1 coding upstream 272440 5748899 ~ 5755254 (+)
CI01000012_06156417_06175135 NA coding downstream 126936 6154847 ~ 6175521 (+)
CI01000012_06182472_06192196 NA coding downstream 153096 6181007 ~ 6192613 (+)
CI01000012_06208439_06217101 BTBD3B, BTBD3 coding downstream 180528 6208439 ~ 6217914 (+)
CI01000012_06334114_06368535 SPTLC3 coding downstream 305438 6333349 ~ 6369091 (+)
CI01000012_06380300_06388370 ISM1 coding downstream 352389 6380300 ~ 6388991 (+)
G71668 NA non-coding upstream 106295 5921193 ~ 5921399 (+)
G71637 NA non-coding upstream 184140 5843064 ~ 5843554 (+)
G71623 NA non-coding upstream 212745 5813517 ~ 5816605 (+)
G71622 NA non-coding upstream 216467 5810037 ~ 5811227 (+)
G71619 NA non-coding upstream 220909 5806521 ~ 5806785 (+)
G72499 NA non-coding downstream 29313 6057224 ~ 6057425 (+)
G72516 NA non-coding downstream 118286 6146197 ~ 6146540 (+)
G72548 NA non-coding downstream 157636 6185547 ~ 6185835 (+)
G72551 NA non-coding downstream 167719 6195630 ~ 6195856 (+)
G72552 NA non-coding downstream 169110 6197021 ~ 6205504 (+)
G71548 NA other upstream 466261 5550493 ~ 5561433 (+)
G71221 NA other upstream 487238 5538525 ~ 5540456 (+)
G71218 NA other upstream 489310 5535852 ~ 5538384 (+)
CI01000012_07806089_07811902 BEND3 other downstream 1778192 7805248 ~ 7811902 (+)
G73578 NA other downstream 2338895 8366806 ~ 8367627 (+)
CI01000012_10223957_10235955 NA other downstream 4194044 10223697 ~ 10236276 (+)
G75533 NA other downstream 5116906 11144817 ~ 11145739 (+)
G76385 NA other downstream 6602844 12630755 ~ 12675666 (+)

Expression


Co-expression Network