G72516


Basic Information

Item Value
gene id G72516
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 6146197 ~ 6146540 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU82716
AGCGACGATAGTGAAGGACGAGAGAGGACCAGGCCTGGACTTTATTTTGTTTTATTATGTTTGTGTGGCCGGCAGACGTCCGCGAGGGTCTGCCGGCATTACTTTCGTTTTGTTCTTTGTTTATTTTATTAAAGTTTATTGTTTGAATGTTCGCCGGTTCCCGCCTCCTTCTTCCCCCATCACTCGAACTGTGTTACATTGGTGCCGAAACCCGGGAGGAAGGAGGGACATGCTGTCGGAGAGCCCTCGCTGCTGAGGGGGATCGCGGTGCTGCGGAGTTCGGGCAGCGCGGGAGTGAAGACCGCGAGAGGCTGCCCGAGGCGGTGGTACTGGAGCCTTGNNNN

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU82716 True 344 lncRNA 0.55 1 6146197 6146540

Neighbor

gene id symbol gene type direction distance location
CI01000012_05946986_05984551 SLX4IP coding upstream 160238 5946986 ~ 5985959 (+)
CI01000012_05923216_05928055 SRD5A2B coding upstream 217011 5922385 ~ 5929186 (+)
CI01000012_05909453_05916000 MEMO1 coding upstream 230023 5909453 ~ 5916174 (+)
CI01000012_05856793_05862577 NA coding upstream 283555 5856316 ~ 5862642 (+)
CI01000012_05748899_05754466 ERLEC1 coding upstream 390943 5748899 ~ 5755254 (+)
CI01000012_06156417_06175135 NA coding downstream 8307 6154847 ~ 6175521 (+)
CI01000012_06182472_06192196 NA coding downstream 34467 6181007 ~ 6192613 (+)
CI01000012_06208439_06217101 BTBD3B, BTBD3 coding downstream 61899 6208439 ~ 6217914 (+)
CI01000012_06334114_06368535 SPTLC3 coding downstream 186809 6333349 ~ 6369091 (+)
CI01000012_06380300_06388370 ISM1 coding downstream 233760 6380300 ~ 6388991 (+)
G72499 NA non-coding upstream 88772 6057224 ~ 6057425 (+)
G72484 NA non-coding upstream 118286 6027694 ~ 6027911 (+)
G71668 NA non-coding upstream 224798 5921193 ~ 5921399 (+)
G71637 NA non-coding upstream 302643 5843064 ~ 5843554 (+)
G71623 NA non-coding upstream 331248 5813517 ~ 5816605 (+)
G72548 NA non-coding downstream 39007 6185547 ~ 6185835 (+)
G72551 NA non-coding downstream 49090 6195630 ~ 6195856 (+)
G72552 NA non-coding downstream 50481 6197021 ~ 6205504 (+)
G72568 NA non-coding downstream 104453 6250993 ~ 6251313 (+)
G72572 NA non-coding downstream 107403 6253943 ~ 6254154 (+)
G71548 NA other upstream 584764 5550493 ~ 5561433 (+)
G71221 NA other upstream 605741 5538525 ~ 5540456 (+)
G71218 NA other upstream 607813 5535852 ~ 5538384 (+)
CI01000012_07806089_07811902 BEND3 other downstream 1659563 7805248 ~ 7811902 (+)
G73578 NA other downstream 2220266 8366806 ~ 8367627 (+)
CI01000012_10223957_10235955 NA other downstream 4075415 10223697 ~ 10236276 (+)
G75533 NA other downstream 4998277 11144817 ~ 11145739 (+)
G76385 NA other downstream 6484215 12630755 ~ 12675666 (+)

Expression


Co-expression Network