G74073


Basic Information

Item Value
gene id G74073
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 7105424 ~ 7105836 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU84487
TCTCATTCAACCATGTTTTAATAAGTAAAGGATGAACAAATATCAGAACATGCAGTTTATTATTTAGAAATTCTTACAAATCAGACTTTTTCAGAGCAATTGTCAAATGTCATTACATGATTATTGTGTTAGTAAAGCATTCTTATATCATGATTTGTTGCTGACATCAAATGTTATCATGACAAATAAAATTCCTATTTTATCAATAGTAAAGACTTCTAGTTCACCATAATTAGCAATAACAAGTAAATTTTATTGCTGCATGAATGTTAAAGCCCCCAAACTGCACTAGAAATATGCTCTATATGCAGCTGTTTTTAAGGACTTTAATTGATTTTATCCATGGCTGGCTCCAGACCTCTATTTTGCACGTAGTGACCTAAAAGAAAAAAGGCAATCTCTTTTAATATGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU84487 True 413 lncRNA 0.30 1 7105424 7105836

Neighbor

gene id symbol gene type direction distance location
CI01000012_07092852_07097731 EPHX5 coding downstream 7693 7092852 ~ 7097731 (-)
CI01000012_07032479_07034631 NA coding downstream 70223 7020730 ~ 7035201 (-)
CI01000012_06989295_06990487 NA coding downstream 114581 6988932 ~ 6990843 (-)
CI01000012_06979304_06984075 NA coding downstream 120480 6979296 ~ 6984944 (-)
CI01000012_06872835_06911259 NA coding downstream 193456 6872715 ~ 6911968 (-)
CI01000012_07113504_07118919 MGME1 coding upstream 7520 7113356 ~ 7119168 (-)
CI01000012_07164949_07166936 NA coding upstream 59003 7164839 ~ 7166936 (-)
CI01000012_07210006_07251043 NA coding upstream 103759 7209595 ~ 7251043 (-)
CI01000012_07268516_07270856 NA coding upstream 162652 7268488 ~ 7270856 (-)
CI01000012_07316139_07320354 NA coding upstream 210194 7314756 ~ 7321193 (-)
G74079 NA non-coding downstream 980 7104053 ~ 7104444 (-)
G74256 NA non-coding downstream 2961 7102190 ~ 7102463 (-)
G74255 NA non-coding downstream 3564 7101425 ~ 7101860 (-)
G74117 NA non-coding downstream 51794 7038496 ~ 7053630 (-)
G74121 NA non-coding upstream 2199 7108035 ~ 7109938 (-)
G74280 NA non-coding upstream 90195 7196031 ~ 7196281 (-)
G74281 NA non-coding upstream 90890 7196726 ~ 7197018 (-)
G74284 NA non-coding upstream 95429 7201265 ~ 7201484 (-)
G74287 NA non-coding upstream 109001 7214837 ~ 7215997 (-)
G72629 NA other downstream 957930 6147011 ~ 6147494 (-)
G72294 NA other downstream 1639567 5462840 ~ 5465857 (-)
CI01000012_05414096_05416676 TTC9 other downstream 1688644 5413369 ~ 5416780 (-)
G72204 NA other downstream 1803218 5293773 ~ 5302206 (-)
G72068 NA other downstream 2325292 4776220 ~ 4780132 (-)
CI01000012_07356934_07358497 NA other upstream 249416 7356863 ~ 7358612 (-)
G74648 NA other upstream 1158493 8264329 ~ 8265654 (-)
G74701 NA other upstream 1261183 8367019 ~ 8367643 (-)
CI01000012_09068458_09070536 NA other upstream 1962070 9067906 ~ 9070765 (-)
CI01000012_09071892_09073410 NA other upstream 1965535 9071371 ~ 9073457 (-)

Expression


Co-expression Network