G73255


Basic Information

Item Value
gene id G73255
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 7347650 ~ 7347902 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU83519
GTTCAAAAGAAGAGCATTTATCTGAAATAGAAAGTTTTGCAACATTATTGTCTAGATTGTTACTTTTGATCAATTTAATGCATCCTTGCTGAATAAAAGTATGAATTTCTTTCATTTCTTTCCAAAAAAAAAGAAAAAAAAAACCCTCTTACTGACCCCAAAATTTTGAAAGGTAGTGATAATGTTACAAAAGCTTTATATTTCAGATAAATTCTGTTCCTTTGAACTTTCTATTAATCAAATAATCCTGAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU83519 True 253 lncRNA 0.26 1 7347650 7347902

Neighbor

gene id symbol gene type direction distance location
CI01000012_07312430_07315865 BTBD6A coding upstream 31733 7311672 ~ 7315917 (+)
CI01000012_07136101_07161117 RRBP1A, RRBP1 coding upstream 186102 7136017 ~ 7161548 (+)
CI01000012_07120539_07126148 SNX5 coding upstream 221378 7120539 ~ 7126272 (+)
CI01000012_07111569_07113225 NA coding upstream 234418 7111569 ~ 7113232 (+)
CI01000012_07108281_07109521 NA coding upstream 237728 7108281 ~ 7109922 (+)
CI01000012_07348648_07352865 NA coding downstream 746 7348648 ~ 7353209 (+)
CI01000012_07359292_07362314 NA coding downstream 10813 7358715 ~ 7362378 (+)
CI01000012_07401962_07405598 NUSAP1 coding downstream 54060 7401962 ~ 7405598 (+)
CI01000012_07409605_07427042 RTF1 coding downstream 61090 7408992 ~ 7427309 (+)
CI01000012_07429147_07434790 GOLGA5 coding downstream 81245 7429147 ~ 7434846 (+)
G73181 NA non-coding upstream 1869 7345506 ~ 7345781 (+)
G73254 NA non-coding upstream 2735 7344595 ~ 7344915 (+)
G73253 NA non-coding upstream 8675 7338770 ~ 7338975 (+)
G73224 NA non-coding upstream 86585 7260860 ~ 7261065 (+)
G73223 NA non-coding upstream 87612 7259826 ~ 7260038 (+)
G73257 NA non-coding downstream 24170 7372072 ~ 7372408 (+)
G73258 NA non-coding downstream 24687 7372589 ~ 7372814 (+)
G73162 NA non-coding downstream 47466 7395368 ~ 7400277 (+)
G73262 NA non-coding downstream 72791 7420693 ~ 7421889 (+)
G73175 NA non-coding downstream 359773 7707675 ~ 7715446 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 1423345 5922385 ~ 5929186 (+)
G71623 NA other upstream 1531045 5813517 ~ 5816605 (+)
G71548 NA other upstream 1786217 5550493 ~ 5561433 (+)
G71221 NA other upstream 1807194 5538525 ~ 5540456 (+)
G71218 NA other upstream 1809266 5535852 ~ 5538384 (+)
CI01000012_07806089_07811902 BEND3 other downstream 458201 7805248 ~ 7811902 (+)
G73578 NA other downstream 1018904 8366806 ~ 8367627 (+)
CI01000012_10223957_10235955 NA other downstream 2874053 10223697 ~ 10236276 (+)
G75533 NA other downstream 3796915 11144817 ~ 11145739 (+)
G76385 NA other downstream 5282853 12630755 ~ 12675666 (+)

Expression


Co-expression Network