G74502



Basic Information


Item Value
gene id G74502
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 7904148 ~ 7904393 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU84976
GAAATTTAGAACTTTTTGGTCACCAACAATCTTCAGAATATCTTCTTTTGTGTTGAGCAGAGGAACAGAGCCATGCAGGTTTTTAACAAAATGAAGGTGAGTAGATTTTTGGGTGCACAATCCCTTTAAAATGTCTGAATGTCACTGCATTAGATTAGACCGCCTGTTGAAGACCCTACACCAATGTTTCCCAAACGTGTCCTGGAGGACCCCCAAAACTGCACATTTTGTATTTCTTCCTCATCA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU84976 True 246 lncRNA 0.40 1 7904148 7904393

Neighbor


gene id symbol gene type direction distance location
CI01000012_07813654_07814853 NA coding downstream 89295 7812900 ~ 7814853 (-)
CI01000012_07761466_07761786 NA coding downstream 142017 7761432 ~ 7762131 (-)
CI01000012_07716912_07750520 SOBPA coding downstream 153628 7716655 ~ 7750520 (-)
CI01000012_07705100_07707005 NA coding downstream 196921 7703949 ~ 7707227 (-)
CI01000012_07556881_07563284 ARG2 coding downstream 340755 7556106 ~ 7563393 (-)
CI01000012_07925520_07928491 RDH14, RDH14A coding upstream 21063 7925456 ~ 7928491 (-)
CI01000012_07930029_07934648 5NT1A, NT5C1BA coding upstream 24899 7929292 ~ 7934881 (-)
CI01000012_07938822_07940632 NA coding upstream 34421 7938814 ~ 7941045 (-)
CI01000012_07956050_07959414 NA coding upstream 51594 7955987 ~ 7959414 (-)
CI01000012_08156754_08159438 OSR1 coding upstream 251676 8156069 ~ 8159438 (-)
G74501 NA non-coding downstream 519 7903296 ~ 7903629 (-)
G74500 NA non-coding downstream 967 7902980 ~ 7903181 (-)
G74498 NA non-coding downstream 5290 7898617 ~ 7898858 (-)
G74492 NA non-coding downstream 34533 7869384 ~ 7869615 (-)
G74490 NA non-coding downstream 48495 7855299 ~ 7855653 (-)
G74504 NA non-coding upstream 1764 7906157 ~ 7906421 (-)
G74508 NA non-coding upstream 32809 7937202 ~ 7937438 (-)
G74546 NA non-coding upstream 141131 8045524 ~ 8045744 (-)
G74547 NA non-coding upstream 142915 8047308 ~ 8047528 (-)
G74548 NA non-coding upstream 146121 8050514 ~ 8050726 (-)
CI01000012_07356934_07358497 NA other downstream 545603 7356863 ~ 7358612 (-)
G72629 NA other downstream 1756654 6147011 ~ 6147494 (-)
G72294 NA other downstream 2438291 5462840 ~ 5465857 (-)
CI01000012_05414096_05416676 TTC9 other downstream 2487368 5413369 ~ 5416780 (-)
G72204 NA other downstream 2601942 5293773 ~ 5302206 (-)
G74648 NA other upstream 359936 8264329 ~ 8265654 (-)
G74701 NA other upstream 462626 8367019 ~ 8367643 (-)
CI01000012_09068458_09070536 NA other upstream 1163513 9067906 ~ 9070765 (-)
CI01000012_09071892_09073410 NA other upstream 1166978 9071371 ~ 9073457 (-)
CI01000012_09082056_09083285 NA other upstream 1178343 9081877 ~ 9083489 (-)

Expression



Co-expression Network