G74981



Basic Information


Item Value
gene id G74981
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 9572222 ~ 9572435 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU85524
GCACCTGAATATGGATATTATCCTTGTATAATACTAAAGTATGATGCATCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTGAGACACAGCATGCTTCCAGCACACCTGAATATGGATATTATCCTTGTATAATACTAAAGTATGATGCATCTATTCTATTCTATTCTATTCTATTCTATTCTGAGAAACAGCATGCTTCCAGCGCACC

Function


NR:

description
PREDICTED: zinc finger and BTB domain-containing protein 7B-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU85524 True 214 lncRNA 0.33 1 9572222 9572435

Neighbor


gene id symbol gene type direction distance location
CI01000012_09513757_09517777 CUEDC2 coding downstream 54445 9513268 ~ 9517777 (-)
CI01000012_09465977_09473475 DNAJB12A coding downstream 98747 9465948 ~ 9473475 (-)
CI01000012_09419200_09460604 SPOCK2 coding downstream 110934 9419095 ~ 9461288 (-)
CI01000012_09400481_09401810 EIF4EBP2 coding downstream 169844 9398076 ~ 9402378 (-)
CI01000012_09379379_09394499 PALD1B coding downstream 177172 9379151 ~ 9395050 (-)
CI01000012_09589749_09615649 PAX2A, PAX2 coding upstream 16009 9588444 ~ 9615649 (-)
CI01000012_09754856_09756772 CHST3A coding upstream 182160 9754595 ~ 9756956 (-)
CI01000012_09782840_09786910 LRIT2 coding upstream 210175 9782610 ~ 9786910 (-)
CI01000012_09789066_09792437 LRIT1A coding upstream 215260 9787695 ~ 9792437 (-)
CI01000012_09830411_09851586 OGDHL coding upstream 257730 9830165 ~ 9851870 (-)
G74976 NA non-coding downstream 16691 9555299 ~ 9555531 (-)
G74973 NA non-coding downstream 28026 9543959 ~ 9544196 (-)
G74971 NA non-coding downstream 31573 9540436 ~ 9540649 (-)
G74969 NA non-coding downstream 34616 9537400 ~ 9537606 (-)
G74968 NA non-coding downstream 34824 9537086 ~ 9537398 (-)
G74982 NA non-coding upstream 3213 9575648 ~ 9576149 (-)
G74986 NA non-coding upstream 12439 9584874 ~ 9585170 (-)
G74994 NA non-coding upstream 58804 9631239 ~ 9631450 (-)
G74996 NA non-coding upstream 63712 9636147 ~ 9636398 (-)
G74997 NA non-coding upstream 64470 9636905 ~ 9637144 (-)
CI01000012_09082056_09083285 NA other downstream 488733 9081877 ~ 9083489 (-)
CI01000012_09071892_09073410 NA other downstream 498765 9071371 ~ 9073457 (-)
CI01000012_09068458_09070536 NA other downstream 501555 9067906 ~ 9070765 (-)
G74701 NA other downstream 1204579 8367019 ~ 8367643 (-)
G75608 NA other upstream 1039480 10611915 ~ 10620871 (-)
CI01000012_12047175_12052116 NA other upstream 2476609 12046728 ~ 12052541 (-)
CI01000012_12079581_12084139 NA other upstream 2506501 12078936 ~ 12084260 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 other upstream 3382011 12954446 ~ 12957833 (-)

Expression



Co-expression Network