G75189


Basic Information

Item Value
gene id G75189
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 9766445 ~ 9769509 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU85765
AAAACTGTAAATATCTCAGATCCAGGCGAAGAGACCTCATAGACATAACCAAAGTAAGGAGTTCCAACAAACACAGGAGGAGTGTCTTGAATGTCAATCACATTTATCGTCAAAGTGGCTGATGATGACATCACTTGTTGCTTGCCCTTGTAAGTGCCACCTCCATCCTTTGCCACCACAGTGATGAAATGTGTGCGGGATTTCTCATAATCGAGGGCTTCGCCTGGTTTTATCCTCAGCACGCCACTATGGTGGTCGATGGCAAACTTTGTGCTCGGTTCACTGCTCTGGAGGAAGTAAGTGACTGATCCCCCTGATCCGGCATCTCTGTCCACTGCCTGCACTTTGTAGATGCTGCTCCCAGATGTAGTGTTCTCTGGCACATCTACGATGGAAGGCATGTTCTGAAACTGTGGTCTCTCATCATTGGCATCCATGACAATAACCGAAACCTTTTCAACTACTTTATTAAGGCCATCTGAGATACTGACAAAGACTTCAATTTCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU85765 True 508 lncRNA 0.46 6 9766445 9769509

Neighbor

gene id symbol gene type direction distance location
CI01000012_09754856_09756772 CHST3A coding downstream 9489 9754595 ~ 9756956 (-)
CI01000012_09589749_09615649 PAX2A, PAX2 coding downstream 150796 9588444 ~ 9615649 (-)
CI01000012_09513757_09517777 CUEDC2 coding downstream 248668 9513268 ~ 9517777 (-)
CI01000012_09465977_09473475 DNAJB12A coding downstream 292970 9465948 ~ 9473475 (-)
CI01000012_09419200_09460604 SPOCK2 coding downstream 305157 9419095 ~ 9461288 (-)
CI01000012_09782840_09786910 LRIT2 coding upstream 13101 9782610 ~ 9786910 (-)
CI01000012_09789066_09792437 LRIT1A coding upstream 18186 9787695 ~ 9792437 (-)
CI01000012_09830411_09851586 OGDHL coding upstream 60656 9830165 ~ 9851870 (-)
CI01000012_09862141_09892366 PARGA, PARG coding upstream 92366 9861875 ~ 9892366 (-)
CI01000012_09894361_09922003 MYOFL coding upstream 124147 9893656 ~ 9922443 (-)
G75004 NA non-coding downstream 124501 9641710 ~ 9641944 (-)
G75001 NA non-coding downstream 126796 9639446 ~ 9639649 (-)
G74997 NA non-coding downstream 129301 9636905 ~ 9637144 (-)
G74996 NA non-coding downstream 130047 9636147 ~ 9636398 (-)
G74994 NA non-coding downstream 134995 9631239 ~ 9631450 (-)
G75212 NA non-coding upstream 46469 9815978 ~ 9817036 (-)
G75230 NA non-coding upstream 217856 9987365 ~ 9987685 (-)
G75645 NA non-coding upstream 316442 10085951 ~ 10086261 (-)
G75646 NA non-coding upstream 316766 10086275 ~ 10086512 (-)
G75647 NA non-coding upstream 319547 10089056 ~ 10089273 (-)
G74982 NA other downstream 190473 9575648 ~ 9576149 (-)
CI01000012_09400481_09401810 EIF4EBP2 other downstream 364477 9398076 ~ 9402378 (-)
CI01000012_09082056_09083285 NA other downstream 682956 9081877 ~ 9083489 (-)
CI01000012_09071892_09073410 NA other downstream 692988 9071371 ~ 9073457 (-)
CI01000012_09068458_09070536 NA other downstream 695778 9067906 ~ 9070765 (-)
G75608 NA other upstream 842406 10611915 ~ 10620871 (-)
CI01000012_12047175_12052116 NA other upstream 2279535 12046728 ~ 12052541 (-)
CI01000012_12079581_12084139 NA other upstream 2309427 12078936 ~ 12084260 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 other upstream 3184937 12954446 ~ 12957833 (-)
G77287 NA other upstream 3849767 13619276 ~ 13633819 (-)

Expression


Co-expression Network