G75646



Basic Information


Item Value
gene id G75646
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 10086275 ~ 10086512 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU86325
GTTTGAATCTCTTGTTTTCTTGATTTACCGTGAGTAACATCAAAGACTATAGAATAACACAAGACGTGTCACTCGTATTGTTTTGAATGGGAGAATGTGCAACGCGGAATATGGCGGAATAGGTCCCGCCTTCTAAATAAGAGCCAATCGCCGATTGGTAAAGTCATCGCGTCACTGCAGCAGCCGTTAGAAGCTCCGGTTCCTATAGAAACAGTCAGACGCACGTTTCCTATCCACC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU86325 True 238 lncRNA 0.45 1 10086275 10086512

Neighbor


gene id symbol gene type direction distance location
CI01000012_09984871_10009730 NA coding downstream 76390 9984306 ~ 10009885 (-)
CI01000012_09976030_09976302 NA coding downstream 109908 9975571 ~ 9976367 (-)
CI01000012_09974294_09974754 NA coding downstream 111219 9973339 ~ 9975056 (-)
CI01000012_09926268_09941904 UNC5B coding downstream 143881 9926073 ~ 9942394 (-)
CI01000012_09894361_09922003 MYOFL coding downstream 163832 9893656 ~ 9922443 (-)
CI01000012_10114837_10117992 NA coding upstream 27884 10114396 ~ 10119291 (-)
CI01000012_10119912_10169990 NA coding upstream 33400 10119912 ~ 10169990 (-)
CI01000012_10189922_10194006 NSMCE4A coding upstream 103364 10189876 ~ 10194006 (-)
CI01000012_10201667_10213604 NA coding upstream 114885 10201397 ~ 10213604 (-)
CI01000012_10217709_10222035 LDB1A, LDB1, LDB1.L coding upstream 130696 10217208 ~ 10222035 (-)
G75645 NA non-coding downstream 14 10085951 ~ 10086261 (-)
G75230 NA non-coding downstream 98590 9987365 ~ 9987685 (-)
G75212 NA non-coding downstream 269239 9815978 ~ 9817036 (-)
G75189 NA non-coding downstream 316766 9766445 ~ 9769509 (-)
G75004 NA non-coding downstream 444331 9641710 ~ 9641944 (-)
G75647 NA non-coding upstream 2544 10089056 ~ 10089273 (-)
G75648 NA non-coding upstream 3493 10090005 ~ 10090218 (-)
G75630 NA non-coding upstream 92617 10179129 ~ 10179830 (-)
G75661 NA non-coding upstream 166608 10253120 ~ 10253362 (-)
G75597 NA non-coding upstream 207334 10293846 ~ 10295724 (-)
G74982 NA other downstream 510303 9575648 ~ 9576149 (-)
CI01000012_09400481_09401810 EIF4EBP2 other downstream 684307 9398076 ~ 9402378 (-)
CI01000012_09082056_09083285 NA other downstream 1002786 9081877 ~ 9083489 (-)
CI01000012_09071892_09073410 NA other downstream 1012818 9071371 ~ 9073457 (-)
CI01000012_09068458_09070536 NA other downstream 1015608 9067906 ~ 9070765 (-)
G75608 NA other upstream 525403 10611915 ~ 10620871 (-)
CI01000012_12047175_12052116 NA other upstream 1962532 12046728 ~ 12052541 (-)
CI01000012_12079581_12084139 NA other upstream 1992424 12078936 ~ 12084260 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 other upstream 2867934 12954446 ~ 12957833 (-)
G77287 NA other upstream 3532764 13619276 ~ 13633819 (-)

Expression



Co-expression Network