G75311


Basic Information

Item Value
gene id G75311
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 10093847 ~ 10094170 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU85896
CACCATTAGAACGTTTCCTTTCCTTTCCTTTCCTTCACGTGACACACCGCGGCCACACTGTATGACAGATGTATCGCTTTTCTCACCATGTCATCAACTATGTGATATTCCGATTCTCATATATTTGCAAGTGAGTGTTCTCATATATTTGCTGATTTTCCCCCAATGATTTTAAAATAAAAGTTTAAACCCTCGCTCTGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU85896 True 202 lncRNA 0.40 2 10093847 10094170

Neighbor

gene id symbol gene type direction distance location
CI01000012_09977219_09983804 NA coding upstream 109981 9977011 ~ 9983866 (+)
CI01000012_09828421_09828926 NA coding upstream 264459 9828421 ~ 9829388 (+)
CI01000012_09815706_09822346 CHATA, CHAT coding upstream 271176 9815706 ~ 9822671 (+)
CI01000012_09812937_09814478 SLC18A3, SLC18A3A coding upstream 278430 9812421 ~ 9815417 (+)
CI01000012_09796386_09801947 RGR, RGRA coding upstream 291303 9796291 ~ 9802544 (+)
CI01000012_10196272_10198737 HPS6 coding downstream 102102 10196272 ~ 10198816 (+)
CI01000012_10223957_10235955 NA coding downstream 129527 10223697 ~ 10236276 (+)
CI01000012_10244843_10249396 NA coding downstream 150673 10244843 ~ 10249499 (+)
CI01000012_10260457_10272063 NT5C2B, NT5C2, NT5C2A coding downstream 165565 10259735 ~ 10272262 (+)
CI01000012_10296725_10299883 CYP17, CYP17A1 coding downstream 202458 10296628 ~ 10301555 (+)
G75258 NA non-coding upstream 30155 10063382 ~ 10063692 (+)
G75148 NA non-coding upstream 106123 9987365 ~ 9987724 (+)
G75147 NA non-coding upstream 107477 9986112 ~ 9986370 (+)
G75115 NA non-coding upstream 161971 9931534 ~ 9931876 (+)
G75113 NA non-coding upstream 171695 9921373 ~ 9922152 (+)
G75272 NA non-coding downstream 44127 10138297 ~ 10140069 (+)
G75277 NA non-coding downstream 98819 10192989 ~ 10193998 (+)
G75339 NA non-coding downstream 120392 10214562 ~ 10214804 (+)
G75340 NA non-coding downstream 120746 10214916 ~ 10215219 (+)
G75276 NA non-coding downstream 180495 10274665 ~ 10277003 (+)
G73578 NA other upstream 1726220 8366806 ~ 8367627 (+)
CI01000012_07806089_07811902 BEND3 other upstream 2285992 7805248 ~ 7811902 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 4169542 5922385 ~ 5929186 (+)
G71623 NA other upstream 4277242 5813517 ~ 5816605 (+)
G71548 NA other upstream 4532414 5550493 ~ 5561433 (+)
G75533 NA other downstream 1050647 11144817 ~ 11145739 (+)
G76385 NA other downstream 2536585 12630755 ~ 12675666 (+)
G76374 NA other downstream 2651361 12745531 ~ 12749169 (+)
CI01000012_13029637_13033226 RGS17 other downstream 2921336 13029435 ~ 13038899 (+)

Expression


Co-expression Network