G75429


Basic Information

Item Value
gene id G75429
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 10460088 ~ 10460387 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU86042
AGCTATTACAGCTTCAACTCTTCTGGGAAGGCTTTCCACAAGGTTTAGGAGTGTGTTTATGGGAATTTTTGACCATTTTTCTAGAAGCGCATTTGTGAGGTCAGGCAGTGATGTTGGCGAGAAGGCCTGGCTCGCAGTCTCCACTCGCTCATCCATGTCTTTATGGACCTTGCTTTGTGCACTGGTGCGCAGTCATGTTGGAACAGGAAGGGGCCATCCCCAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU86042 True 224 lncRNA 0.49 2 10460088 10460387

Neighbor

gene id symbol gene type direction distance location
CI01000012_10296725_10299883 CYP17, CYP17A1 coding upstream 158533 10296628 ~ 10301555 (+)
CI01000012_10260457_10272063 NT5C2B, NT5C2, NT5C2A coding upstream 187826 10259735 ~ 10272262 (+)
CI01000012_10244843_10249396 NA coding upstream 210589 10244843 ~ 10249499 (+)
CI01000012_10223957_10235955 NA coding upstream 223812 10223697 ~ 10236276 (+)
CI01000012_10196272_10198737 HPS6 coding upstream 261272 10196272 ~ 10198816 (+)
CI01000012_10469322_10470665 LBX1A, LBX1 coding downstream 8196 10468583 ~ 10471373 (+)
CI01000012_10489814_10496226 TLX1, TLX1.L coding downstream 29340 10489727 ~ 10496584 (+)
CI01000012_10499885_10500843 SDHAF4 coding downstream 38828 10499215 ~ 10501778 (+)
CI01000012_10502102_10533782 NA coding downstream 41715 10502102 ~ 10533942 (+)
CI01000012_10572910_10604787 NA coding downstream 112443 10572830 ~ 10605280 (+)
G75356 NA non-coding upstream 139328 10320542 ~ 10320760 (+)
G75355 NA non-coding upstream 140803 10318993 ~ 10319285 (+)
G75349 NA non-coding upstream 166643 10293213 ~ 10293445 (+)
G75276 NA non-coding upstream 183085 10274665 ~ 10277003 (+)
G75340 NA non-coding upstream 244869 10214916 ~ 10215219 (+)
G75442 NA non-coding downstream 58816 10519203 ~ 10520123 (+)
G75467 NA non-coding downstream 225630 10686017 ~ 10686254 (+)
G75468 NA non-coding downstream 226078 10686465 ~ 10686685 (+)
G75469 NA non-coding downstream 226300 10686687 ~ 10687042 (+)
G73578 NA other upstream 2092461 8366806 ~ 8367627 (+)
CI01000012_07806089_07811902 BEND3 other upstream 2652233 7805248 ~ 7811902 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 4535783 5922385 ~ 5929186 (+)
G71623 NA other upstream 4643483 5813517 ~ 5816605 (+)
G75533 NA other downstream 684430 11144817 ~ 11145739 (+)
G76385 NA other downstream 2170368 12630755 ~ 12675666 (+)
G76374 NA other downstream 2285144 12745531 ~ 12749169 (+)
CI01000012_13029637_13033226 RGS17 other downstream 2555119 13029435 ~ 13038899 (+)
G76645 NA other downstream 3191472 13651859 ~ 13652234 (+)

Expression


Co-expression Network