G75814



Basic Information


Item Value
gene id G75814
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 10796420 ~ 10796654 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU86503
CTTTTGCAATCAATCTCCCATATACAATGATGTGTCCAACTGTACTGTTAAAATTGATATATGCCATACAAAGTGCAGTCTTGTGCAGTTTCAATCACTGTCATAAAAACTGTAGCCATAGTTTACATCTGAAATATTCATCACTGTTATATTGACAACATGGCTAAGCATTTTGACTATCTTGTTCGAGAACAATGACACAAGGACTTGTCATTCTGATGGCACTGATATGTTC

Function


NR:

description
PREDICTED: eosinophil peroxidase-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU86503 True 235 lncRNA 0.35 1 10796420 10796654

Neighbor


gene id symbol gene type direction distance location
CI01000012_10705713_10710443 ASRGL1 coding downstream 85977 10705713 ~ 10710443 (-)
CI01000012_10696109_10703071 NA coding downstream 93234 10687849 ~ 10703186 (-)
CI01000012_10639383_10640319 NA coding downstream 155572 10639161 ~ 10640848 (-)
CI01000012_10626417_10638842 B3GAT2 coding downstream 157457 10625889 ~ 10638963 (-)
CI01000012_10395715_10408849 SLC2A15A coding downstream 387571 10395628 ~ 10408849 (-)
CI01000012_10799203_10801485 NA coding upstream 2124 10798778 ~ 10801537 (-)
CI01000012_10837437_10841732 NA coding upstream 40761 10837415 ~ 10841804 (-)
CI01000012_10934571_10937915 NA coding upstream 137845 10934499 ~ 10937915 (-)
CI01000012_10939589_10944243 EEF1A1B, EEF1A1, EEF1A1A, EEF1A1.L, EF1A1 coding upstream 142301 10938955 ~ 10944243 (-)
CI01000012_10947838_10952009 SLC17A5 coding upstream 151184 10947838 ~ 10952009 (-)
G75607 NA non-coding downstream 5211 10764163 ~ 10791209 (-)
G75796 NA non-coding downstream 32340 10714098 ~ 10764080 (-)
G75751 NA non-coding downstream 245200 10550070 ~ 10551220 (-)
G75601 NA non-coding downstream 295344 10490985 ~ 10501076 (-)
G75875 NA non-coding upstream 123567 10920221 ~ 10922346 (-)
G75892 NA non-coding upstream 126068 10922722 ~ 10927672 (-)
G75931 NA non-coding upstream 322866 11119520 ~ 11119825 (-)
G75932 NA non-coding upstream 323289 11119943 ~ 11121104 (-)
G75933 NA non-coding upstream 324650 11121304 ~ 11121901 (-)
G75608 NA other downstream 175549 10611915 ~ 10620871 (-)
G74982 NA other downstream 1220448 9575648 ~ 9576149 (-)
CI01000012_09400481_09401810 EIF4EBP2 other downstream 1394452 9398076 ~ 9402378 (-)
CI01000012_09082056_09083285 NA other downstream 1712931 9081877 ~ 9083489 (-)
CI01000012_09071892_09073410 NA other downstream 1722963 9071371 ~ 9073457 (-)
CI01000012_12047175_12052116 NA other upstream 1252390 12046728 ~ 12052541 (-)
CI01000012_12079581_12084139 NA other upstream 1282282 12078936 ~ 12084260 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 other upstream 2157792 12954446 ~ 12957833 (-)
G77287 NA other upstream 2822622 13619276 ~ 13633819 (-)

Expression



Co-expression Network