G75571


Basic Information

Item Value
gene id G75571
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 11162228 ~ 11162545 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU86195
TATTGGCCAGCCAACATGCCTGACCTGAATCTATGGGATATTTTCAAGAGAAAGATGAGAAACAGTTGATCCAACAATATACAGATGATCTGAAGGCTCAATAGTGCCTCAGCAGTGCCACAGGCTGATCACTTCCATGCCACACTTCACTGATGCTGTAATTTGTGCTAGGAGCAAGTCATTTGCTGTAATATGTGCTGCCGACCAAGTATTGAGTGCACAAATGAACATACTTTAAGGAACTTGAACTTTTCTGTTTTGCAAATCCATTTTTTGATTGATCTTAGGAAATATTCTAATATTTTGAGATACTGGATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU86195 True 318 lncRNA 0.39 1 11162228 11162545

Neighbor

gene id symbol gene type direction distance location
CI01000012_11091957_11093675 CCDC85A coding upstream 68454 11091957 ~ 11093774 (+)
CI01000012_11043669_11044569 NA coding upstream 117587 11043394 ~ 11044670 (+)
CI01000012_11011437_11013922 NA coding upstream 148297 11011364 ~ 11013931 (+)
CI01000012_10922409_10930704 DDX43 coding upstream 230943 10922409 ~ 10931285 (+)
CI01000012_10892631_10918617 KCNQ5 coding upstream 243611 10892631 ~ 10918617 (+)
CI01000012_11277561_11292490 VRK2 coding downstream 115016 11277561 ~ 11292636 (+)
CI01000012_11319849_11326035 NA coding downstream 156515 11319060 ~ 11326904 (+)
CI01000012_11616967_11694276 NA coding downstream 453002 11615547 ~ 11694284 (+)
CI01000012_11698150_11702986 NA coding downstream 534570 11697115 ~ 11703213 (+)
CI01000012_11859839_11869022 PAPOLG coding downstream 697204 11859749 ~ 11870657 (+)
G75566 NA non-coding upstream 7170 11154771 ~ 11155058 (+)
G75563 NA non-coding upstream 9844 11152059 ~ 11152384 (+)
G75554 NA non-coding upstream 26623 11135373 ~ 11135605 (+)
G75552 NA non-coding upstream 28539 11133368 ~ 11133689 (+)
G75578 NA non-coding downstream 6008 11168553 ~ 11168781 (+)
G75583 NA non-coding downstream 11942 11174487 ~ 11174715 (+)
G75588 NA non-coding downstream 22516 11185061 ~ 11185287 (+)
G76018 NA non-coding downstream 89272 11251817 ~ 11252102 (+)
G75533 NA other upstream 16489 11144817 ~ 11145739 (+)
CI01000012_10223957_10235955 NA other upstream 937941 10223697 ~ 10236276 (+)
G73578 NA other upstream 2794601 8366806 ~ 8367627 (+)
CI01000012_07806089_07811902 BEND3 other upstream 3354373 7805248 ~ 7811902 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 5237923 5922385 ~ 5929186 (+)
G76385 NA other downstream 1468210 12630755 ~ 12675666 (+)
G76374 NA other downstream 1582986 12745531 ~ 12749169 (+)
CI01000012_13029637_13033226 RGS17 other downstream 1852961 13029435 ~ 13038899 (+)
G76645 NA other downstream 2489314 13651859 ~ 13652234 (+)
G76656 NA other downstream 2540942 13703487 ~ 13739731 (+)

Expression


Co-expression Network