G76261


Basic Information

Item Value
gene id G76261
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 11895999 ~ 11896199 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU87010
TGCTAAAGAAGCTGAGGGTACCTAAACCCTATTGAGCATCTGTGGGGCGTCCTCAAACGGAAGGTGGAGGAGCGCAAGGTCTCTAACATCCACCAGCTCCGTGATGTCGTCACGGAGGAGTGGAAGAGGACTCCAGTGGCAACCTGTGAAGCTCTGGTGAACTCCATGCCCAAAAGGGTTAAGGCAGTACTGGGAAATAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU87010 True 201 lncRNA 0.53 1 11895999 11896199

Neighbor

gene id symbol gene type direction distance location
CI01000012_11874504_11884601 REL coding upstream 10707 11874504 ~ 11885292 (+)
CI01000012_11859839_11869022 PAPOLG coding upstream 25342 11859749 ~ 11870657 (+)
CI01000012_11698150_11702986 NA coding upstream 192786 11697115 ~ 11703213 (+)
CI01000012_11616967_11694276 NA coding upstream 201715 11615547 ~ 11694284 (+)
CI01000012_11319849_11326035 NA coding upstream 569095 11319060 ~ 11326904 (+)
CI01000012_11897443_11903607 PDLIM1 coding downstream 1244 11897443 ~ 11903607 (+)
CI01000012_11913513_11921468 SGPL1 coding downstream 17314 11913513 ~ 11921935 (+)
CI01000012_11932267_11962143 NA coding downstream 36068 11932267 ~ 11962208 (+)
CI01000012_11981083_11993407 RET coding downstream 84884 11981083 ~ 11994093 (+)
CI01000012_11995593_12005292 CGAT2, CSGALNACT2 coding downstream 99394 11995593 ~ 12005352 (+)
G76181 NA non-coding upstream 54188 11840055 ~ 11841811 (+)
G76152 NA non-coding upstream 101781 11794011 ~ 11794218 (+)
G76151 NA non-coding upstream 103850 11791948 ~ 11792149 (+)
G76150 NA non-coding upstream 104357 11791343 ~ 11791642 (+)
G76148 NA non-coding upstream 107090 11788691 ~ 11788909 (+)
G76198 NA non-coding downstream 24060 11920259 ~ 11925517 (+)
G76247 NA non-coding downstream 68325 11964524 ~ 11965309 (+)
G76212 NA non-coding downstream 129644 12025843 ~ 12029190 (+)
G76236 NA non-coding downstream 134091 12030290 ~ 12031920 (+)
G76281 NA non-coding downstream 137604 12033803 ~ 12034004 (+)
G75533 NA other upstream 750260 11144817 ~ 11145739 (+)
CI01000012_10223957_10235955 NA other upstream 1671712 10223697 ~ 10236276 (+)
G73578 NA other upstream 3528372 8366806 ~ 8367627 (+)
CI01000012_07806089_07811902 BEND3 other upstream 4088144 7805248 ~ 7811902 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 5971694 5922385 ~ 5929186 (+)
G76385 NA other downstream 734556 12630755 ~ 12675666 (+)
G76374 NA other downstream 849332 12745531 ~ 12749169 (+)
CI01000012_13029637_13033226 RGS17 other downstream 1119307 13029435 ~ 13038899 (+)
G76645 NA other downstream 1755660 13651859 ~ 13652234 (+)
G76656 NA other downstream 1807288 13703487 ~ 13739731 (+)

Expression


Co-expression Network