G76293


Basic Information

Item Value
gene id G76293
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 12068838 ~ 12069166 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU87042
TTCAAGAAAAAGGAGCAGCATCCAGACTTCTTCTCCTCAGTGGGGTGGGTTCGCACTTTATCCTCAGCCAAATAGGGATTAGACAGATTCAGTTGGTTCATGTTCTCCAAAGAACTGTGAAACATGGGCTGAGGGTCGTAGATGGTGCTGATGGGGCGTCTGATGGGTGCAGGAGAGCCACTGTAGGCCTGATTCACCCAGGCTCCTTTCCCAAAGTTATCCAGCTCGCACGCTACTGTACTGCCCAGCTGATTTTCTGCCCGGTTATTGAGGTGTTGCATCGTAGTAAATTGAGAGGTTAAGGTAGATGGATTTATCATGAAATGCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU87042 True 329 lncRNA 0.49 1 12068838 12069166

Neighbor

gene id symbol gene type direction distance location
CI01000012_12054427_12060390 TIAL1 coding upstream 8448 12054427 ~ 12060390 (+)
CI01000012_12016924_12024791 MCMBP coding upstream 43803 12016924 ~ 12025035 (+)
CI01000012_11995593_12005292 CGAT2, CSGALNACT2 coding upstream 63486 11995593 ~ 12005352 (+)
CI01000012_11981083_11993407 RET coding upstream 74745 11981083 ~ 11994093 (+)
CI01000012_11932267_11962143 NA coding upstream 106630 11932267 ~ 11962208 (+)
CI01000012_12128962_12130578 ITPRIP coding downstream 59280 12128446 ~ 12132127 (+)
CI01000012_12159352_12162539 NA coding downstream 89482 12158648 ~ 12162839 (+)
CI01000012_12173747_12212480 VCLA, VCL coding downstream 104222 12173388 ~ 12213285 (+)
CI01000012_12220568_12234927 NA coding downstream 150832 12219998 ~ 12235263 (+)
CI01000012_12270454_12276521 NA coding downstream 201180 12270346 ~ 12276625 (+)
G76290 NA non-coding upstream 23525 12045077 ~ 12045313 (+)
G76220 NA non-coding upstream 24653 12043779 ~ 12044185 (+)
G76289 NA non-coding upstream 25676 12042883 ~ 12043162 (+)
G76288 NA non-coding upstream 26259 12042365 ~ 12042579 (+)
G76287 NA non-coding upstream 26527 12042032 ~ 12042311 (+)
G76299 NA non-coding downstream 7744 12076910 ~ 12077124 (+)
G76306 NA non-coding downstream 41261 12110427 ~ 12110646 (+)
G76315 NA non-coding downstream 95017 12164183 ~ 12164411 (+)
G76316 NA non-coding downstream 95795 12164961 ~ 12165232 (+)
G76318 NA non-coding downstream 99002 12168168 ~ 12168455 (+)
G75533 NA other upstream 923099 11144817 ~ 11145739 (+)
CI01000012_10223957_10235955 NA other upstream 1844551 10223697 ~ 10236276 (+)
G73578 NA other upstream 3701211 8366806 ~ 8367627 (+)
CI01000012_07806089_07811902 BEND3 other upstream 4260983 7805248 ~ 7811902 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 6144533 5922385 ~ 5929186 (+)
G76385 NA other downstream 561589 12630755 ~ 12675666 (+)
G76374 NA other downstream 676365 12745531 ~ 12749169 (+)
CI01000012_13029637_13033226 RGS17 other downstream 946340 13029435 ~ 13038899 (+)
G76645 NA other downstream 1582693 13651859 ~ 13652234 (+)
G76656 NA other downstream 1634321 13703487 ~ 13739731 (+)

Expression


Co-expression Network