G76328


Basic Information

Item Value
gene id G76328
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 12437694 ~ 12437915 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU87078
CACCTGTTCTGCTGAGAGCATCATGAATGTAGTGTGCTGAAGGGTGGAAAAAAGGTGAAATATCGAATGTAGGCAGATCATTGGCCGGAACACCATAGTACTTCACGGTTGTCCCATAAAAATCATCACTTCCTTTGCAACACATTTTACCATGTGCAGCATTTAAAACATGAGTTATACCCAGTCTCCATAGGCCATATCTGTCATGAGACATGTACCTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU87078 True 222 lncRNA 0.42 1 12437694 12437915

Neighbor

gene id symbol gene type direction distance location
CI01000012_12381049_12417489 KAT6B coding upstream 18997 12380192 ~ 12418697 (+)
CI01000012_12378120_12378419 NA coding upstream 59032 12378120 ~ 12378662 (+)
CI01000012_12292583_12371612 ADK, ADKA coding upstream 66082 12292583 ~ 12371612 (+)
CI01000012_12270454_12276521 NA coding upstream 161069 12270346 ~ 12276625 (+)
CI01000012_12220568_12234927 NA coding upstream 202431 12219998 ~ 12235263 (+)
CI01000012_12440074_12465741 SLKA, SLKB, SLK coding downstream 2159 12440074 ~ 12466032 (+)
CI01000012_12489485_12490402 NA coding downstream 51372 12489287 ~ 12490431 (+)
CI01000012_12505469_12509093 ERLIN1, ERLIN2 coding downstream 67554 12505469 ~ 12509316 (+)
CI01000012_12536242_12538668 NA coding downstream 98161 12536076 ~ 12538728 (+)
CI01000012_12585843_12587149 NA coding downstream 147928 12585843 ~ 12587209 (+)
G76244 NA non-coding upstream 204 12437112 ~ 12437490 (+)
G76230 NA non-coding upstream 1369 12436031 ~ 12436325 (+)
G76222 NA non-coding upstream 2633 12433669 ~ 12435061 (+)
G76327 NA non-coding upstream 4536 12432899 ~ 12433158 (+)
G76318 NA non-coding upstream 269239 12168168 ~ 12168455 (+)
G76329 NA non-coding downstream 94 12438009 ~ 12438229 (+)
G76232 NA non-coding downstream 41725 12479640 ~ 12486248 (+)
G76332 NA non-coding downstream 54734 12492649 ~ 12492849 (+)
G76335 NA non-coding downstream 58920 12496835 ~ 12499657 (+)
G76340 NA non-coding downstream 63205 12501120 ~ 12501330 (+)
G75533 NA other upstream 1291955 11144817 ~ 11145739 (+)
CI01000012_10223957_10235955 NA other upstream 2213407 10223697 ~ 10236276 (+)
G73578 NA other upstream 4070067 8366806 ~ 8367627 (+)
CI01000012_07806089_07811902 BEND3 other upstream 4629839 7805248 ~ 7811902 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 6513389 5922385 ~ 5929186 (+)
G76385 NA other downstream 192840 12630755 ~ 12675666 (+)
G76374 NA other downstream 307616 12745531 ~ 12749169 (+)
CI01000012_13029637_13033226 RGS17 other downstream 577591 13029435 ~ 13038899 (+)
G76645 NA other downstream 1213944 13651859 ~ 13652234 (+)
G76656 NA other downstream 1265572 13703487 ~ 13739731 (+)

Expression


Co-expression Network