G77202


Basic Information

Item Value
gene id G77202
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 12916431 ~ 12916673 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU88048
ACTGGAAGGTTATAAAAAAAATAAAAAAAAATCAACTGCTCCAGTGAGATGGTCTTCAGTTTCCTTTCTCACTCTTTCTCACTGACTCCCTCTCTCTCTCGCTCTCTCTCCCTCTCTCACTCACTCTCTCTCTCTCTCCTCACTTCCTGTGGTGCTCTCGCAGCCTTCTTCTCTGCAGTGGTGCACGGCAGGAAGAGCAGCGAAGGCTGGAGGATGACAAACAGCCATTACCTCCATTAAAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU88048 True 243 lncRNA 0.48 1 12916431 12916673

Neighbor

gene id symbol gene type direction distance location
CI01000012_12902396_12904687 AGT coding downstream 10810 12902161 ~ 12905621 (-)
CI01000012_12872801_12891084 PGBD5 coding downstream 25347 12871862 ~ 12891084 (-)
CI01000012_12811846_12819195 NA coding downstream 97070 12811734 ~ 12819361 (-)
CI01000012_12783994_12795809 NA coding downstream 119862 12783924 ~ 12796569 (-)
CI01000012_12751670_12759821 ABCB10 coding downstream 156610 12751273 ~ 12759821 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 coding upstream 37787 12954446 ~ 12957833 (-)
CI01000012_12960774_12964242 OPRM1 coding upstream 43028 12959701 ~ 12964929 (-)
CI01000012_12977279_12978570 NA coding upstream 60349 12977022 ~ 12978817 (-)
CI01000012_13015424_13018020 NA coding upstream 98701 13015374 ~ 13019645 (-)
CI01000012_13041401_13060443 PCNXL2 coding upstream 123979 13040652 ~ 13060443 (-)
G77201 NA non-coding downstream 2508 12913698 ~ 12913923 (-)
G77200 NA non-coding downstream 3320 12912848 ~ 12913111 (-)
G77198 NA non-coding downstream 7522 12908629 ~ 12908909 (-)
G76975 NA non-coding downstream 14754 12900414 ~ 12901677 (-)
G76982 NA non-coding downstream 17072 12898355 ~ 12899359 (-)
G77205 NA non-coding upstream 2259 12918932 ~ 12919313 (-)
G77207 NA non-coding upstream 4905 12921578 ~ 12921802 (-)
G77237 NA non-coding upstream 125340 13042013 ~ 13042222 (-)
G77238 NA non-coding upstream 125868 13042541 ~ 13042765 (-)
G77243 NA non-coding upstream 145232 13061905 ~ 13062333 (-)
CI01000012_12079581_12084139 NA other downstream 832171 12078936 ~ 12084260 (-)
CI01000012_12047175_12052116 NA other downstream 864224 12046728 ~ 12052541 (-)
G75608 NA other downstream 2295560 10611915 ~ 10620871 (-)
G74982 NA other downstream 3340459 9575648 ~ 9576149 (-)
CI01000012_09400481_09401810 EIF4EBP2 other downstream 3514463 9398076 ~ 9402378 (-)
G77287 NA other upstream 702603 13619276 ~ 13633819 (-)

Expression


Co-expression Network