CI01000013_02666598_02669821 (NUDT21, CPSF5, NUDT21.L)


Basic Information

Item Value
gene id CI01000013_02666598_02669821
gene name NUDT21, CPSF5, NUDT21.L
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 2666598 ~ 2669821 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000013_02666598_02669821.mRNA
ATGTCAGTTGTACCTCCGAATCGATCATCTACCGGTTGGCCTCGTGGAGTAAATCAGTTCGGTAATAAATACATTAGCCAGCCGGCTAAACCGCTCACCCTGGAGAGAACAATCAACCTATACCCACTAACAAATTACACATTCGGCACCAAGGAGCCGCTCTATGAGAAGGACAGCTCGGTAGCCGCACGCTTTCAGCGGATGCGGGAGGAGTTTGAGAAAATCGGGATGCGGCGGACTGTGGAGGGGGTTCTGATCGTGCATGAGCACAGACTCCCTCACGTGCTGCTTCTGCAGCTGGGAACCACCTTCTTCAAACTTCCTGGTGGAGAGTTGAACCCTGGAGAAGATGAGGTGGAGGGGTTGAAACGACTGATGACAGAGATTTTGGGGCGTCAGGATGGAGTAAAGCAGGACTGGGTCATTGATGACTGTATTGGGAACTGGTGGAGACCAAACTTTGAGCCGCCTCAGGTGTACCCCTATATTCCAGCACACATCACTAAACCTAAAGAACATAAGAAGCTTTTTCTAGTACAGCTGCAAGAGAAAGCATTATTTGCTGTGCCAAAGAACTATAAGCTGGTGGCCGCCCCCTTGTTTGAGCTTTATGATAATGCTCCTGGCTACGGCCCGATTATATCCAGTCTTCCACAGCTACTGAGCAG

Function

symbol description
nudt21 Predicted to enable identical protein binding activity and mRNA 3'-UTR AU-rich region binding activity. Predicted to be involved in several processes, including positive regulation of cell differentiation; protein-containing complex assembly; and regulation of mRNA metabolic process. Predicted to act upstream of or within cell differentiation and mRNA polyadenylation. Predicted to be located in cytoplasm and paraspeckles. Predicted to be part of mRNA cleavage factor complex. Orthologous to human NUDT21 (nudix hydrolase 21).
cpsf5 Predicted to enable mRNA binding activity. Predicted to be involved in mRNA processing. Predicted to be part of mRNA cleavage factor complex. Is expressed in embryonic brain; larval ventral nerve cord; and organism. Orthologous to human NUDT21 (nudix hydrolase 21).

GO:

id name namespace
GO:0003674 molecular_function molecular_function

KEGG:

id description
K14397 NUDT21, CPSF5, CFIM25; cleavage and polyadenylation specificity factor subunit 5

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000013_02666598_02669821.mRNA True 668 mRNA 0.50 6 2666598 2669821

Neighbor

gene id symbol gene type direction distance location
CI01000013_02656037_02664145 HSF4 coding upstream 2200 2656037 ~ 2664398 (+)
CI01000013_02528016_02529126 NA coding upstream 137352 2527448 ~ 2529246 (+)
CI01000013_02510121_02510417 NA coding upstream 156064 2510083 ~ 2513164 (+)
CI01000013_02411870_02429950 NA coding upstream 236641 2410427 ~ 2429957 (+)
CI01000013_02409027_02409452 NA coding upstream 256991 2407306 ~ 2409607 (+)
CI01000013_02685665_02686639 NA coding downstream 12646 2682467 ~ 2686835 (+)
CI01000013_02692887_02696848 NA coding downstream 22622 2692443 ~ 2697020 (+)
CI01000013_02709871_02711692 NA coding downstream 39632 2709453 ~ 2712499 (+)
CI01000013_02815238_02816664 NA coding downstream 145359 2815180 ~ 2817323 (+)
CI01000013_02859975_02863496 TMEM170A coding downstream 190154 2859975 ~ 2863946 (+)
G79358 NA non-coding upstream 68227 2595938 ~ 2598371 (+)
G79344 NA non-coding upstream 93075 2572701 ~ 2573523 (+)
G79332 NA non-coding upstream 139668 2526106 ~ 2526930 (+)
G79310 NA non-coding upstream 197485 2468883 ~ 2469113 (+)
G79402 NA non-coding downstream 24891 2694712 ~ 2695125 (+)
G79397 NA non-coding downstream 64283 2734104 ~ 2748629 (+)
G79440 NA non-coding downstream 97632 2767453 ~ 2767739 (+)
G79441 NA non-coding downstream 98656 2768477 ~ 2769076 (+)
G79442 NA non-coding downstream 99656 2769477 ~ 2769829 (+)
G79309 NA other upstream 199427 2466765 ~ 2467171 (+)
G77695 NA other upstream 1713629 946521 ~ 952969 (+)
G77533 NA other upstream 1957049 708833 ~ 709549 (+)
G80062 NA other downstream 914187 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 1395112 4050837 ~ 4065829 (+)
G80845 NA other downstream 2165257 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 3386477 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 3408741 6075400 ~ 6081684 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_013425 nudt21 coding NC_007129.7 CM002902.2 22721551 ~ 22735002 (-)