CI01000013_03937929_03938255 (FAM180B)


Basic Information

Item Value
gene id CI01000013_03937929_03938255
gene name FAM180B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 3937929 ~ 3938261 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000013_03937929_03938255.mRNA
TTCTTATGGAGGGGACTGGAGATTGATGTCGACAGTAATGTTGTCATGCGGGATCAAGAAATAGCATCCATGCGACAAGGGCGAGCTTTCTTATCTCTTATAAACGACAGTATTCCAAAAACTGTGTCTGCAATGGAGAAGTTACTGGCTACGCTGGAAGAGCAAGACAACTCTTTCACTCAGGCACATTTTGAGACCCTCATCCTCGGGACTATCTATTCAGCCTACCAGGTCCAAAACCAGAGACTGGAGTCAGAACAGCAGGCCTGGACTGATATTCTTGGTCGTCTTGCAAATGTTACTTTCGTTCAGCTACGCAAGTCTTAACTAACA

Function

symbol description
fam180b Predicted to be located in extracellular region.

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000013_03937929_03938255.mRNA True 333 mRNA 0.45 1 3937929 3938261

Neighbor

gene id symbol gene type direction distance location
CI01000013_03902606_03908849 IGHMBP2 coding upstream 28871 3902606 ~ 3909058 (+)
CI01000013_03885988_03895027 KIAA1147 coding upstream 42902 3885988 ~ 3895027 (+)
CI01000013_03856173_03872356 BCL2L13 coding upstream 64982 3856173 ~ 3872947 (+)
CI01000013_03843207_03852634 WNT2 coding upstream 83904 3843207 ~ 3854025 (+)
CI01000013_03823326_03839656 ASZ1 coding upstream 98019 3823326 ~ 3839910 (+)
CI01000013_03949848_03950925 NA coding downstream 11587 3949848 ~ 3951293 (+)
CI01000013_03952621_03964132 KIF23 coding downstream 14360 3952621 ~ 3964234 (+)
CI01000013_04051081_04064651 NA coding downstream 112576 4050837 ~ 4065829 (+)
CI01000013_04084679_04088148 NA coding downstream 145553 4083814 ~ 4090171 (+)
CI01000013_04316134_04317091 NA coding downstream 377873 4316134 ~ 4317198 (+)
G80144 NA non-coding upstream 9379 3928322 ~ 3928550 (+)
G80143 NA non-coding upstream 10205 3927170 ~ 3927724 (+)
G80088 NA non-coding upstream 131214 3806054 ~ 3806715 (+)
G80087 NA non-coding upstream 132459 3805215 ~ 3805470 (+)
G80083 NA non-coding upstream 144529 3793004 ~ 3793400 (+)
G80105 NA non-coding downstream 8543 3946804 ~ 3948697 (+)
G80153 NA non-coding downstream 72054 4010315 ~ 4010552 (+)
G80168 NA non-coding downstream 117572 4055833 ~ 4056059 (+)
G80062 NA other upstream 353145 3584008 ~ 3584784 (+)
G79309 NA other upstream 1470758 2466765 ~ 2467171 (+)
G77695 NA other upstream 2984960 946521 ~ 952969 (+)
G77533 NA other upstream 3228380 708833 ~ 709549 (+)
G80845 NA other downstream 896817 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 2118037 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 2140301 6075400 ~ 6081684 (+)
G81994 NA other downstream 3397684 7335945 ~ 7338239 (+)

Expression


Co-expression Network