G77505


Basic Information

Item Value
gene id G77505
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 134702 ~ 135653 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU88383
AAAAATCCTTAGCGTTGAGCCCTGGTCTGAGAAGTGGGATATGAAAATGATGGTAAGCTTACCCACAAACATAACAGTGCCAATCTTGGTGGGTTGCCCAGGAACCTCAACTTTACAGCGGTTTCCAACAGCGATGGCTTCAGCCGCTGCCTTCTCTTCCTCTTCTTTCTTAGCAAGAGCCTCTTCTTGTTTGGCCCTGTTTTCCTCATTAAAACGACCTAACTTCATATTCTTCTTGAAGCTCCGTATCGAATCTGGCCCTTTTTTCATAGGCATCATCAGAGATCTCAAATTTCTCCACCTTCGACAAATCAGTGAACTCTCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU88383 True 326 lncRNA 0.45 2 134702 135653

Neighbor

gene id symbol gene type direction distance location
CI01000013_00082083_00124049 YAP1 coding upstream 10653 82083 ~ 124049 (+)
CI01000013_00055395_00073103 NA coding upstream 61270 54114 ~ 73432 (+)
CI01000013_00142867_00148461 SIX5 coding downstream 7214 142867 ~ 149008 (+)
CI01000013_00151644_00152374 SIX9 coding downstream 15482 151135 ~ 153096 (+)
CI01000013_00259782_00293697 MAP3K10 coding downstream 124129 259782 ~ 293697 (+)
CI01000013_00432775_00439564 RCN2 coding downstream 297122 432775 ~ 439579 (+)
CI01000013_00441663_00456168 PSTPIP1A coding downstream 306010 441663 ~ 456456 (+)
G77541 NA non-coding upstream 20265 89806 ~ 114437 (+)
G77555 NA non-coding upstream 76284 58062 ~ 58418 (+)
G77562 NA non-coding downstream 25930 161583 ~ 161803 (+)
G77507 NA non-coding downstream 26642 162295 ~ 165109 (+)
G77534 NA non-coding downstream 157505 293158 ~ 300396 (+)
G77538 NA non-coding downstream 222848 358501 ~ 359239 (+)
G77635 NA non-coding downstream 235918 371571 ~ 371944 (+)
G77533 NA other downstream 573180 708833 ~ 709549 (+)
G77695 NA other downstream 810868 946521 ~ 952969 (+)
G79309 NA other downstream 2331112 2466765 ~ 2467171 (+)
G80062 NA other downstream 3448355 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 3929280 4050837 ~ 4065829 (+)

Expression


Co-expression Network