G77724


Basic Information

Item Value
gene id G77724
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 837329 ~ 837561 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU88611
TTTACAGTGATAACAGGAACATAATTTGGGCTGTACAACAGCTCTAGACAAAAATAGTGTCATTGTCCAGCTTAAGAAGTTCAGTATTGATTCATTTCCGTTGTAAAAATCATTAGTTATTAATTTAGTTCATTTATCTATACAGTCATGTCATCATCCAGCTCAGTTCAGTTCTCATATAATGGTGTCAATGCAGGCAGATCAGTAATATTGTTGAGTGTTAAATATCCCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU88611 True 233 lncRNA 0.34 1 837329 837561

Neighbor

gene id symbol gene type direction distance location
CI01000013_00657437_00692874 FRMD5 coding upstream 144455 657437 ~ 692874 (+)
CI01000013_00561825_00581324 NA coding upstream 255753 560823 ~ 581576 (+)
CI01000013_00526975_00537006 SLC28A1 coding upstream 300255 526975 ~ 537074 (+)
CI01000013_00490680_00491519 CH25HL1.1 coding upstream 345699 490616 ~ 491630 (+)
CI01000013_00473761_00488628 NA coding upstream 348497 473138 ~ 488832 (+)
CI01000013_00849127_00850710 ANKRD34C coding downstream 11029 848590 ~ 850969 (+)
CI01000013_00862608_00869073 IDH2, IDHP, IDH2.S coding downstream 24857 862418 ~ 869073 (+)
CI01000013_00870861_00871425 IDH2 coding downstream 33300 870861 ~ 871522 (+)
CI01000013_01007844_01029438 SEMA4B, SEMA4BA coding downstream 170283 1007844 ~ 1029459 (+)
CI01000013_01036536_01049545 NA coding downstream 198975 1036536 ~ 1049882 (+)
G77712 NA non-coding upstream 52873 783781 ~ 784456 (+)
G77536 NA non-coding upstream 126822 710116 ~ 710507 (+)
G77528 NA non-coding upstream 130074 706543 ~ 707255 (+)
G77509 NA non-coding upstream 135252 698039 ~ 702077 (+)
G77530 NA non-coding upstream 202490 616917 ~ 634839 (+)
G77725 NA non-coding downstream 136 837697 ~ 838044 (+)
G77729 NA non-coding downstream 13869 851430 ~ 853530 (+)
G77736 NA non-coding downstream 55103 892664 ~ 892941 (+)
G77739 NA non-coding downstream 60189 897750 ~ 897950 (+)
G77747 NA non-coding downstream 71036 908597 ~ 908910 (+)
G77533 NA other upstream 127780 708833 ~ 709549 (+)
G77695 NA other downstream 108960 946521 ~ 952969 (+)
G79309 NA other downstream 1629204 2466765 ~ 2467171 (+)
G80062 NA other downstream 2746447 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 3227372 4050837 ~ 4065829 (+)
G80845 NA other downstream 3997517 4835078 ~ 4836232 (+)

Expression


Co-expression Network