G77826


Basic Information

Item Value
gene id G77826
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 1181202 ~ 1181428 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU88716
AAAAAACTATTTCAATTAAATGCTGTTTTCTTAAACTTTCTATTCATCAAAGAATCCTGAAAAATGTATCACCATTTCCATAAAAATATTAAAGTGCCCCTGAAATCAAAATTTAAGTTTTTTAGATTTTAGTATGAATATGTTAGCCTTAAGGTTATGAATAAGCTGGTGTGTTCTAAAACAATGACAAAATTCGCATTTAGGAGATATGAGCATTTAAAACTTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU88716 True 227 lncRNA 0.26 1 1181202 1181428

Neighbor

gene id symbol gene type direction distance location
CI01000013_01115756_01164524 NA coding upstream 16678 1115756 ~ 1166617 (+)
CI01000013_01036536_01049545 NA coding upstream 131320 1036536 ~ 1049882 (+)
CI01000013_01007844_01029438 SEMA4B, SEMA4BA coding upstream 151743 1007844 ~ 1029459 (+)
CI01000013_00870861_00871425 IDH2 coding upstream 309680 870861 ~ 871522 (+)
CI01000013_00862608_00869073 IDH2, IDHP, IDH2.S coding upstream 312129 862418 ~ 869073 (+)
CI01000013_01220794_01229752 GNRHR4 coding downstream 39366 1220794 ~ 1230958 (+)
CI01000013_01275415_01295230 PLIN1 coding downstream 93694 1275122 ~ 1295324 (+)
CI01000013_01335438_01381270 SLCO3A1 coding downstream 154010 1335438 ~ 1381270 (+)
CI01000013_01405290_01429838 NA coding downstream 223862 1405290 ~ 1430313 (+)
CI01000013_01443540_01469011 CHD2 coding downstream 262112 1443540 ~ 1469076 (+)
G77800 NA non-coding upstream 107373 1073502 ~ 1073829 (+)
G77765 NA non-coding upstream 243745 937249 ~ 937457 (+)
G77747 NA non-coding upstream 272292 908597 ~ 908910 (+)
G77739 NA non-coding upstream 283252 897750 ~ 897950 (+)
G77829 NA non-coding downstream 5481 1186909 ~ 1187191 (+)
G77894 NA non-coding downstream 135823 1317251 ~ 1317663 (+)
G77895 NA non-coding downstream 136293 1317721 ~ 1317963 (+)
G77875 NA non-coding downstream 289392 1470820 ~ 1471360 (+)
G77695 NA other upstream 228233 946521 ~ 952969 (+)
G77533 NA other upstream 471653 708833 ~ 709549 (+)
G79309 NA other downstream 1285337 2466765 ~ 2467171 (+)
G80062 NA other downstream 2402580 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 2883505 4050837 ~ 4065829 (+)
G80845 NA other downstream 3653650 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 4874870 6049864 ~ 6060269 (+)

Expression


Co-expression Network