G78019


Basic Information

Item Value
gene id G78019
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 1631803 ~ 1632003 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU88925
ATTTTCTTGTCTTTTAAAGGGATAGTTTAACCAAAAATGAAAAAGATGTCATCACTTACTCACCCTCATTATTCCAATCCAAACCTGTGTTCTTTCTTCTGTTGAACACAAAAGAAGATATTTTAAAAATATTGGTAACCAGGCAGTTGATGGTATTTTTTTTTCCTACGATGGAAGTCAATGGCTACACTCAACTGTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU88925 True 201 lncRNA 0.33 1 1631803 1632003

Neighbor

gene id symbol gene type direction distance location
CI01000013_01443540_01469011 CHD2 coding upstream 162727 1443540 ~ 1469076 (+)
CI01000013_01405290_01429838 NA coding upstream 201490 1405290 ~ 1430313 (+)
CI01000013_01335438_01381270 SLCO3A1 coding upstream 250533 1335438 ~ 1381270 (+)
CI01000013_01275415_01295230 PLIN1 coding upstream 336479 1275122 ~ 1295324 (+)
CI01000013_01220794_01229752 GNRHR4 coding upstream 400845 1220794 ~ 1230958 (+)
CI01000013_01762491_01764612 NA coding downstream 129755 1761758 ~ 1764805 (+)
CI01000013_01950237_01964249 NA coding downstream 318012 1950015 ~ 1964290 (+)
CI01000013_01989323_01993472 NR2F2.L, NR2F2 coding downstream 356528 1988531 ~ 1994075 (+)
CI01000013_02033469_02034368 NA coding downstream 401112 2033115 ~ 2034738 (+)
CI01000013_02081079_02127936 NA coding downstream 448663 2080666 ~ 2128269 (+)
G78017 NA non-coding upstream 731 1630809 ~ 1631072 (+)
G78010 NA non-coding upstream 11950 1619615 ~ 1619853 (+)
G77981 NA non-coding upstream 14799 1616704 ~ 1617004 (+)
G78008 NA non-coding upstream 18027 1613509 ~ 1613776 (+)
G77946 NA non-coding upstream 101228 1530320 ~ 1530575 (+)
G78020 NA non-coding downstream 188 1632191 ~ 1632513 (+)
CI01000013_01629280_01635701 NA non-coding downstream 2054 1629228 ~ 1635772 (+)
G78028 NA non-coding downstream 10566 1642569 ~ 1643119 (+)
G78032 NA non-coding downstream 18565 1650568 ~ 1650776 (+)
G78073 NA non-coding downstream 73390 1705393 ~ 1705660 (+)
G77695 NA other upstream 678834 946521 ~ 952969 (+)
G77533 NA other upstream 922254 708833 ~ 709549 (+)
G79309 NA other downstream 834762 2466765 ~ 2467171 (+)
G80062 NA other downstream 1952005 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 2432930 4050837 ~ 4065829 (+)
G80845 NA other downstream 3203075 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 4424295 6049864 ~ 6060269 (+)

Expression


Co-expression Network