G79241


Basic Information

Item Value
gene id G79241
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 2316730 ~ 2316943 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU90259
ATTAAATGCAAAACAAAAATCAATAAAGTATACATCTTATGATTAGCATGTTTGCAGTTTATGATTTACTGCAATAATCATATTTTTTTTGGGCTTAGTCTTTTATTTATATTCCTTATTTTTATTAATAGGTTATTTCTTAAAGATAAGCAGTGAAGCAATTTTGTTAAAATAGTAATATTTGAAGGTTTTGCAAACTGTGGTGAAATGTAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU90259 True 214 lncRNA 0.24 1 2316730 2316943

Neighbor

gene id symbol gene type direction distance location
CI01000013_02081079_02127936 NA coding upstream 188461 2080666 ~ 2128269 (+)
CI01000013_02033469_02034368 NA coding upstream 281992 2033115 ~ 2034738 (+)
CI01000013_01989323_01993472 NR2F2.L, NR2F2 coding upstream 322655 1988531 ~ 1994075 (+)
CI01000013_01950237_01964249 NA coding upstream 352440 1950015 ~ 1964290 (+)
CI01000013_01762491_01764612 NA coding upstream 551925 1761758 ~ 1764805 (+)
CI01000013_02386700_02394730 NA coding downstream 69405 2386348 ~ 2395296 (+)
CI01000013_02409027_02409452 NA coding downstream 90363 2407306 ~ 2409607 (+)
CI01000013_02411870_02429950 NA coding downstream 93484 2410427 ~ 2429957 (+)
CI01000013_02510121_02510417 NA coding downstream 193140 2510083 ~ 2513164 (+)
CI01000013_02528016_02529126 NA coding downstream 210505 2527448 ~ 2529246 (+)
G79232 NA non-coding upstream 13035 2303317 ~ 2303695 (+)
G79075 NA non-coding upstream 185979 2130518 ~ 2130751 (+)
G78265 NA non-coding upstream 336656 1979842 ~ 1980074 (+)
G78264 NA non-coding upstream 337201 1979275 ~ 1979529 (+)
G78263 NA non-coding upstream 338002 1978383 ~ 1978728 (+)
G79185 NA non-coding downstream 54787 2371730 ~ 2385188 (+)
G79194 NA non-coding downstream 102578 2419521 ~ 2420107 (+)
G79290 NA non-coding downstream 119499 2436442 ~ 2436843 (+)
G79291 NA non-coding downstream 120705 2437648 ~ 2437854 (+)
G79303 NA non-coding downstream 140445 2457388 ~ 2457601 (+)
G77695 NA other upstream 1363761 946521 ~ 952969 (+)
G77533 NA other upstream 1607181 708833 ~ 709549 (+)
G79309 NA other downstream 149822 2466765 ~ 2467171 (+)
G80062 NA other downstream 1267065 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 1747990 4050837 ~ 4065829 (+)
G80845 NA other downstream 2518135 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 3739355 6049864 ~ 6060269 (+)

Expression


Co-expression Network