G79485


Basic Information

Item Value
gene id G79485
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 2818081 ~ 2818490 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU90529
CAGACATCTTGAGCTCCTTCTTTCAATCCACTACAGAGCTTGATGCTGATTTTAACGGATCAGTTTCTTCCCCTCTAACGGTTTTTCAGCAGAAAACATCAATTTGTGTTGTTAGGATTCTCTCGGAGTCCTTCTATTCCATGTTGTCTGTAGTAAAGGTGCTATCCGCGCCTCGATGGGGTGAGAAGTTTAATGTGAATGTTTCAGATGTGTCTCCGCTCCACCTCTCACGGGCAGCGCTGCGCAGTTTCAGCCCTCCTCTCCAGAGATCTGCTGCTGGGCAGGATAATAAAATGGTTGTTTAGATTAAAACGCTTCTCTTCTTCACTCGTTTTTCCCCCCGTGCAGTAAAGAATGACCTGTCTTTGGTTTGCCTGTATTGCGGTAGCGTACACTGACACTTCATAGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU90529 True 410 lncRNA 0.46 1 2818081 2818490

Neighbor

gene id symbol gene type direction distance location
CI01000013_02815238_02816664 NA coding upstream 758 2815180 ~ 2817323 (+)
CI01000013_02709871_02711692 NA coding upstream 105582 2709453 ~ 2712499 (+)
CI01000013_02692887_02696848 NA coding upstream 121061 2692443 ~ 2697020 (+)
CI01000013_02685665_02686639 NA coding upstream 131246 2682467 ~ 2686835 (+)
CI01000013_02666598_02669821 NUDT21, CPSF5, NUDT21.L coding upstream 148260 2666598 ~ 2669821 (+)
CI01000013_02859975_02863496 TMEM170A coding downstream 41485 2859975 ~ 2863946 (+)
CI01000013_03019688_03044233 TSNAXIP1, PARD6A coding downstream 201198 3019688 ~ 3044374 (+)
CI01000013_03087239_03094115 TSNAXIP1 coding downstream 268749 3087239 ~ 3094458 (+)
CI01000013_03121085_03147061 EDC4 coding downstream 302595 3121085 ~ 3147622 (+)
CI01000013_03186643_03190449 NRN1LA coding downstream 368153 3186643 ~ 3190677 (+)
G79484 NA non-coding upstream 391 2817425 ~ 2817690 (+)
G79481 NA non-coding upstream 1972 2815804 ~ 2816109 (+)
G79479 NA non-coding upstream 4573 2813171 ~ 2813508 (+)
G79478 NA non-coding upstream 5192 2812687 ~ 2812889 (+)
G79523 NA non-coding downstream 6602 2825092 ~ 2825318 (+)
G79517 NA non-coding downstream 55524 2874014 ~ 2875003 (+)
G79540 NA non-coding downstream 58473 2876963 ~ 2877788 (+)
G79541 NA non-coding downstream 59737 2878227 ~ 2878450 (+)
G79542 NA non-coding downstream 60855 2879345 ~ 2880489 (+)
G79309 NA other upstream 350910 2466765 ~ 2467171 (+)
G77695 NA other upstream 1865112 946521 ~ 952969 (+)
G77533 NA other upstream 2108532 708833 ~ 709549 (+)
G80062 NA other downstream 765518 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 1246443 4050837 ~ 4065829 (+)
G80845 NA other downstream 2016588 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 3237808 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 3260072 6075400 ~ 6081684 (+)

Expression


Co-expression Network