G79639


Basic Information

Item Value
gene id G79639
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 3201911 ~ 3202313 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU90688
CATGAATCATGTAAATTATAGAATATATTTTAAATTTAAAACGGCAAAATTTAATAAAAAACAAGTTGAGTAGTTTGCATTACTAGATATTACTGTCGGTCATTGAACATTTCTATCGTAAACAGTTGTCAAATATTAAACTACTTGCATCCTACCACACACTCTTTCACTGTTGGAATTCGCACTCAACTTCTGTTAACAGTAAGCCCCGCCTTCTTTGATTTGATTGGCCATCTCAATCATTTTGACATTGACGAGTGCTGTTAGATCACTGAGGTAGACCAGGCAAAAAATGTAACTTTTAAAACTTGTTGTCATCCTAACAACAAACAATTTACCGCGGGCCCCCCTTAAGCATAGGGCCCGGTGTAGTCGCACCAGTTGCACCGCCTTAAGGACACCC

Function

NR:

description
PREDICTED: calmodulin-binding transcription activator 1-like isoform X1

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU90688 True 403 lncRNA 0.38 1 3201911 3202313

Neighbor

gene id symbol gene type direction distance location
CI01000013_03186643_03190449 NRN1LA coding upstream 11234 3186643 ~ 3190677 (+)
CI01000013_03121085_03147061 EDC4 coding upstream 54289 3121085 ~ 3147622 (+)
CI01000013_03087239_03094115 TSNAXIP1 coding upstream 107453 3087239 ~ 3094458 (+)
CI01000013_03019688_03044233 TSNAXIP1, PARD6A coding upstream 157537 3019688 ~ 3044374 (+)
CI01000013_02859975_02863496 TMEM170A coding upstream 337965 2859975 ~ 2863946 (+)
CI01000013_03225714_03236717 FAN1 coding downstream 23401 3225714 ~ 3237045 (+)
CI01000013_03241607_03258684 MBTPS1 coding downstream 39294 3241607 ~ 3259203 (+)
CI01000013_03262979_03269729 SLC38A8A coding downstream 60666 3262979 ~ 3269882 (+)
CI01000013_03457529_03463949 PNP6 coding downstream 255216 3457529 ~ 3465011 (+)
CI01000013_03477151_03488842 CALB2, CALB2A coding downstream 274727 3477040 ~ 3489333 (+)
G79503 NA non-coding upstream 7103 3192354 ~ 3194808 (+)
G79625 NA non-coding upstream 88844 3112613 ~ 3113067 (+)
G79601 NA non-coding upstream 154379 3047236 ~ 3047532 (+)
G79600 NA non-coding upstream 188158 3013211 ~ 3013753 (+)
G79598 NA non-coding upstream 189843 3011662 ~ 3012068 (+)
G79909 NA non-coding downstream 163229 3365542 ~ 3365893 (+)
G79976 NA non-coding downstream 171615 3373928 ~ 3374243 (+)
G79994 NA non-coding downstream 187632 3389945 ~ 3390326 (+)
G80003 NA non-coding downstream 209182 3411495 ~ 3412005 (+)
G80058 NA non-coding downstream 328122 3530435 ~ 3530847 (+)
G79309 NA other upstream 734740 2466765 ~ 2467171 (+)
G77695 NA other upstream 2248942 946521 ~ 952969 (+)
G77533 NA other upstream 2492362 708833 ~ 709549 (+)
G80062 NA other downstream 381695 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 862620 4050837 ~ 4065829 (+)
G80845 NA other downstream 1632765 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 2853985 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 2876249 6075400 ~ 6081684 (+)

Expression


Co-expression Network