G79994


Basic Information

Item Value
gene id G79994
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 3389945 ~ 3390326 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU91080
GTCGTAATTCACTGGCACTGGATGGTTTTGTAGCATAACTGTCTTTTGATGGTTTCTTACTTCCCAAGCCTTTCCTCTGTGCGGGAATGGAGGCGTTTTTACACATCCTAATGTAAAAACGCATCTCAAAGTTGCCTTTATTCTCCACAGTGAGAGTCTGTTTTTTACGTGAGCCATACACCAGTGGGCCAAAGTTGATATCATTATTGGGACTGATACTGTATTTGGAGAAAAGTGCCTGGACTGACACTTTGATTGGTATAGTATTAATGGTCTCCCCACCCTCCAGATTGGGCTCAATAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU91080 True 303 lncRNA 0.43 2 3389945 3390326

Neighbor

gene id symbol gene type direction distance location
CI01000013_03262979_03269729 SLC38A8A coding upstream 120063 3262979 ~ 3269882 (+)
CI01000013_03241607_03258684 MBTPS1 coding upstream 130742 3241607 ~ 3259203 (+)
CI01000013_03225714_03236717 FAN1 coding upstream 152900 3225714 ~ 3237045 (+)
CI01000013_03186643_03190449 NRN1LA coding upstream 199268 3186643 ~ 3190677 (+)
CI01000013_03121085_03147061 EDC4 coding upstream 242323 3121085 ~ 3147622 (+)
CI01000013_03457529_03463949 PNP6 coding downstream 67203 3457529 ~ 3465011 (+)
CI01000013_03477151_03488842 CALB2, CALB2A coding downstream 86714 3477040 ~ 3489333 (+)
CI01000013_03493064_03499971 GOT2, GOT2A, GOT2B coding downstream 102738 3493064 ~ 3500131 (+)
CI01000013_03501267_03503856 NA coding downstream 110941 3501267 ~ 3504388 (+)
CI01000013_03505522_03510594 NA coding downstream 115196 3505522 ~ 3510717 (+)
G79976 NA non-coding upstream 15702 3373928 ~ 3374243 (+)
G79909 NA non-coding upstream 24052 3365542 ~ 3365893 (+)
G79639 NA non-coding upstream 187632 3201911 ~ 3202313 (+)
G79503 NA non-coding upstream 195137 3192354 ~ 3194808 (+)
G79625 NA non-coding upstream 276878 3112613 ~ 3113067 (+)
G80003 NA non-coding downstream 21169 3411495 ~ 3412005 (+)
G80058 NA non-coding downstream 140109 3530435 ~ 3530847 (+)
G80041 NA non-coding downstream 212037 3602363 ~ 3652575 (+)
G80040 NA non-coding downstream 316397 3706723 ~ 3708228 (+)
G80037 NA non-coding downstream 318631 3708957 ~ 3712091 (+)
G79309 NA other upstream 922774 2466765 ~ 2467171 (+)
G77695 NA other upstream 2436976 946521 ~ 952969 (+)
G77533 NA other upstream 2680396 708833 ~ 709549 (+)
G80062 NA other downstream 193682 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 674607 4050837 ~ 4065829 (+)
G80845 NA other downstream 1444752 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 2665972 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 2688236 6075400 ~ 6081684 (+)

Expression


Co-expression Network