G80058


Basic Information

Item Value
gene id G80058
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 3530435 ~ 3530847 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU91151
TGCTCCAACTGTGTGTTTGTAGAGCACATTTGTTATGGCTAGAAAAACTATGATCTGGGCTGTGTTGTAAGCCAAAGCTGATCAGTTTAGGTTTACAATGCTTTGGGAAACACAGTCATAATGATTGTGTTTTGATGAGGACATTCTCATTGTAAAATGGCCAGATTCATTGGTGACATCCAGTATTAACCGGTCATATAGATGTTGTATTATTTCTTTATAGTAAATCTGTTACCACTTGAGATCCAGCAGAGCTTTTATAATCTGAAGTTTTTTTTGAAACACACACAGACATCAAGAATCAGCATATGACCCTCAACAATGGTGACAATCAAACAAAGTGCTTCATGTTGCAGTGCATGATGGGAGCCACCAATCAAAACTCATCCATGGCTCCCATCATTCATTGCTGC

Function

NR:

description
PREDICTED: zinc finger and BTB domain-containing protein 40-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU91151 True 413 lncRNA 0.38 1 3530435 3530847

Neighbor

gene id symbol gene type direction distance location
CI01000013_03505522_03510594 NA coding upstream 19718 3505522 ~ 3510717 (+)
CI01000013_03501267_03503856 NA coding upstream 26047 3501267 ~ 3504388 (+)
CI01000013_03493064_03499971 GOT2, GOT2A, GOT2B coding upstream 30304 3493064 ~ 3500131 (+)
CI01000013_03477151_03488842 CALB2, CALB2A coding upstream 41102 3477040 ~ 3489333 (+)
CI01000013_03457529_03463949 PNP6 coding upstream 65424 3457529 ~ 3465011 (+)
CI01000013_03565240_03566364 NA coding downstream 34289 3565136 ~ 3566551 (+)
CI01000013_03570185_03581155 NA coding downstream 39242 3570089 ~ 3581729 (+)
CI01000013_03617490_03705093 IGF1R, IGF1RA coding downstream 86643 3617490 ~ 3705093 (+)
CI01000013_03715150_03721616 SYNM coding downstream 184303 3715150 ~ 3721731 (+)
CI01000013_03744519_03787129 CTTNBP2 coding downstream 213672 3744519 ~ 3788177 (+)
G80003 NA non-coding upstream 118430 3411495 ~ 3412005 (+)
G79994 NA non-coding upstream 140109 3389945 ~ 3390326 (+)
G79976 NA non-coding upstream 156192 3373928 ~ 3374243 (+)
G79909 NA non-coding upstream 164542 3365542 ~ 3365893 (+)
G79639 NA non-coding upstream 328122 3201911 ~ 3202313 (+)
G80041 NA non-coding downstream 71516 3602363 ~ 3652575 (+)
G80040 NA non-coding downstream 175876 3706723 ~ 3708228 (+)
G80037 NA non-coding downstream 178110 3708957 ~ 3712091 (+)
G80068 NA non-coding downstream 182129 3712976 ~ 3713187 (+)
G80069 NA non-coding downstream 182450 3713297 ~ 3713517 (+)
G79309 NA other upstream 1063264 2466765 ~ 2467171 (+)
G77695 NA other upstream 2577466 946521 ~ 952969 (+)
G77533 NA other upstream 2820886 708833 ~ 709549 (+)
G80062 NA other downstream 53161 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 534086 4050837 ~ 4065829 (+)
G80845 NA other downstream 1304231 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 2525451 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 2547715 6075400 ~ 6081684 (+)

Expression


Co-expression Network