G80069


Basic Information

Item Value
gene id G80069
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 3713297 ~ 3713517 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU91162
CCTCCCAGCATCTCTGGAGTAGATGACATCAAGTCCCATATTTTTTAAATGCTTGCTAAGGGACCTCATGTCTATGATAGAGTCCAGTCGTTCTGGTCCTCCCTCAATACAGCAATGATGAACAGGGCAAAGACCACTCACATCTCTGTCTTTGTAGTAGTGGTTCTTGCCTGTTTGCTCCAGTGTAATGCCTTTGGCTCCTGGGGCTATGCCCAAATGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU91162 True 221 lncRNA 0.47 1 3713297 3713517

Neighbor

gene id symbol gene type direction distance location
CI01000013_03617490_03705093 IGF1R, IGF1RA coding upstream 8204 3617490 ~ 3705093 (+)
CI01000013_03570185_03581155 NA coding upstream 131568 3570089 ~ 3581729 (+)
CI01000013_03565240_03566364 NA coding upstream 146746 3565136 ~ 3566551 (+)
CI01000013_03505522_03510594 NA coding upstream 202580 3505522 ~ 3510717 (+)
CI01000013_03501267_03503856 NA coding upstream 208909 3501267 ~ 3504388 (+)
CI01000013_03715150_03721616 SYNM coding downstream 1633 3715150 ~ 3721731 (+)
CI01000013_03744519_03787129 CTTNBP2 coding downstream 31002 3744519 ~ 3788177 (+)
CI01000013_03823326_03839656 ASZ1 coding downstream 109809 3823326 ~ 3839910 (+)
CI01000013_03843207_03852634 WNT2 coding downstream 129690 3843207 ~ 3854025 (+)
CI01000013_03856173_03872356 BCL2L13 coding downstream 142656 3856173 ~ 3872947 (+)
G80068 NA non-coding upstream 110 3712976 ~ 3713187 (+)
G80037 NA non-coding upstream 1206 3708957 ~ 3712091 (+)
G80040 NA non-coding upstream 5069 3706723 ~ 3708228 (+)
G80041 NA non-coding upstream 60722 3602363 ~ 3652575 (+)
G80058 NA non-coding upstream 182450 3530435 ~ 3530847 (+)
G80072 NA non-coding downstream 18626 3732143 ~ 3740009 (+)
G80075 NA non-coding downstream 26759 3740276 ~ 3740559 (+)
G80081 NA non-coding downstream 79150 3792667 ~ 3792881 (+)
G80083 NA non-coding downstream 79487 3793004 ~ 3793400 (+)
G80087 NA non-coding downstream 91698 3805215 ~ 3805470 (+)
G80062 NA other upstream 128513 3584008 ~ 3584784 (+)
G79309 NA other upstream 1246126 2466765 ~ 2467171 (+)
G77695 NA other upstream 2760328 946521 ~ 952969 (+)
G77533 NA other upstream 3003748 708833 ~ 709549 (+)
CI01000013_04051081_04064651 NA other downstream 351416 4050837 ~ 4065829 (+)
G80845 NA other downstream 1121561 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 2342781 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 2365045 6075400 ~ 6081684 (+)
G81994 NA other downstream 3622428 7335945 ~ 7338239 (+)

Expression


Co-expression Network