G80512


Basic Information

Item Value
gene id G80512
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 4223453 ~ 4224034 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU91650
TCCTGGATGAGAGGAGGAGGGGGAGGGATATAATTTGTCTCCATTGCCGGCATGCTGGGAGCCCGTGCCAGTGGAGACGCCTGATGATGCAGATTCAACACTCCTTTGTTGACAGGTGGGGAGGTGGGTGATAGAGATGGACAGGCTCTTTTAGGTGGAGGCTCGTCGTCATCATCATCTGAGGAGCTGTCCAGCGTCAAGTCAATTACTTCCACTTTCTTACTGCTACTGTGGGACGAACTGTTTCTGTGGTCTGATACAACAGACCGACACGAGTCTACAAGAGAGGAGCATAAAAAAAACAGACCTCCCTGAATCAAATAGCAAGTCAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU91650 True 333 lncRNA 0.50 2 4223453 4224034

Neighbor

gene id symbol gene type direction distance location
CI01000013_04084679_04088148 NA coding upstream 133831 4083814 ~ 4090171 (+)
CI01000013_04051081_04064651 NA coding upstream 158284 4050837 ~ 4065829 (+)
CI01000013_03952621_03964132 KIF23 coding upstream 259219 3952621 ~ 3964234 (+)
CI01000013_03949848_03950925 NA coding upstream 272160 3949848 ~ 3951293 (+)
CI01000013_03937929_03938255 FAM180B coding upstream 285192 3937929 ~ 3938261 (+)
CI01000013_04316134_04317091 NA coding downstream 92100 4316134 ~ 4317198 (+)
CI01000013_04344339_04347938 AAGAB coding downstream 120305 4344339 ~ 4348083 (+)
CI01000013_04425884_04426805 NA coding downstream 201714 4425748 ~ 4427010 (+)
CI01000013_04505188_04527744 NA coding downstream 281111 4505145 ~ 4527872 (+)
CI01000013_04542059_04550082 LCTLB, LCTL coding downstream 318025 4542059 ~ 4550307 (+)
G80529 NA non-coding upstream 4422 4218648 ~ 4219031 (+)
G80506 NA non-coding upstream 16742 4206137 ~ 4206711 (+)
G80518 NA non-coding upstream 39561 4183672 ~ 4183892 (+)
G80505 NA non-coding upstream 96324 4126914 ~ 4127129 (+)
G80493 NA non-coding upstream 107071 4116159 ~ 4116382 (+)
G80614 NA non-coding downstream 188260 4412294 ~ 4412508 (+)
G80616 NA non-coding downstream 189063 4413097 ~ 4413304 (+)
G80607 NA non-coding downstream 192227 4416261 ~ 4444625 (+)
G80775 NA non-coding downstream 238721 4462755 ~ 4463021 (+)
G80812 NA non-coding downstream 293121 4517155 ~ 4517368 (+)
G80062 NA other upstream 638669 3584008 ~ 3584784 (+)
G79309 NA other upstream 1756282 2466765 ~ 2467171 (+)
G77695 NA other upstream 3270484 946521 ~ 952969 (+)
G77533 NA other upstream 3513904 708833 ~ 709549 (+)
G80845 NA other downstream 611044 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 1832264 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 1854528 6075400 ~ 6081684 (+)
G81994 NA other downstream 3111911 7335945 ~ 7338239 (+)
G82168 NA other downstream 3804304 8028338 ~ 8041343 (+)

Expression


Co-expression Network