G80775


Basic Information

Item Value
gene id G80775
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 4462755 ~ 4463021 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU91952
GTCATGGCCTAATGGTTAGAGAGTTATATTGGTAACCAGAAGGTTGTGGGTTCGATTCTCAATAACGGCAGATAATGACTGAGGTGCCCTTGAGCAAGGCACCTACTACCCCTAATCGCTCCCCGGGTGCCACAGCAAAAATGGCTGCCTACTGCTCCGGGTGTGTGTGTCCACATTTTGCAGTGTGTGTGTGTTCACTACTCACTACTCCTAATGTGTGTTCACTAAGTTGGATGGGTTAAATGCAGAGGACAAATTCAGATTATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU91952 True 267 lncRNA 0.47 1 4462755 4463021

Neighbor

gene id symbol gene type direction distance location
CI01000013_04425884_04426805 NA coding upstream 35745 4425748 ~ 4427010 (+)
CI01000013_04344339_04347938 AAGAB coding upstream 114672 4344339 ~ 4348083 (+)
CI01000013_04316134_04317091 NA coding upstream 145557 4316134 ~ 4317198 (+)
CI01000013_04084679_04088148 NA coding upstream 373133 4083814 ~ 4090171 (+)
CI01000013_04051081_04064651 NA coding upstream 397586 4050837 ~ 4065829 (+)
CI01000013_04505188_04527744 NA coding downstream 42124 4505145 ~ 4527872 (+)
CI01000013_04542059_04550082 LCTLB, LCTL coding downstream 79038 4542059 ~ 4550307 (+)
CI01000013_04612468_04618550 NA coding downstream 149033 4612054 ~ 4619000 (+)
CI01000013_04657029_04672057 MEGF11 coding downstream 193782 4656803 ~ 4672742 (+)
CI01000013_04673313_04707104 MEGF11 coding downstream 210195 4673216 ~ 4707470 (+)
G80607 NA non-coding upstream 18130 4416261 ~ 4444625 (+)
G80616 NA non-coding upstream 49451 4413097 ~ 4413304 (+)
G80614 NA non-coding upstream 50247 4412294 ~ 4412508 (+)
G80512 NA non-coding upstream 238721 4223453 ~ 4224034 (+)
G80529 NA non-coding upstream 243724 4218648 ~ 4219031 (+)
G80812 NA non-coding downstream 54134 4517155 ~ 4517368 (+)
G80814 NA non-coding downstream 58187 4521208 ~ 4521446 (+)
G80815 NA non-coding downstream 59397 4522418 ~ 4522651 (+)
G80817 NA non-coding downstream 62356 4525377 ~ 4525649 (+)
G80818 NA non-coding downstream 67347 4530368 ~ 4530615 (+)
G80062 NA other upstream 877971 3584008 ~ 3584784 (+)
G79309 NA other upstream 1995584 2466765 ~ 2467171 (+)
G77695 NA other upstream 3509786 946521 ~ 952969 (+)
G77533 NA other upstream 3753206 708833 ~ 709549 (+)
G80845 NA other downstream 372057 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 1593277 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 1615541 6075400 ~ 6081684 (+)
G81994 NA other downstream 2872924 7335945 ~ 7338239 (+)
G82168 NA other downstream 3565317 8028338 ~ 8041343 (+)

Expression


Co-expression Network