G80830


Basic Information

Item Value
gene id G80830
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 4571198 ~ 4571553 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU92008
GGTAGATAAACTTATAGTTTCGTTTCGCTATTAGTAGAGACAGTGCTGCCGTGAGAGATCCGGCATATTAATCAGTCCCACACACAAGAGTGTTTTAAGGACAAAAACCTGACTAACGTCCTGAAATACACCATCAAAACAGTGTCTTGAGGTGTGGTAACCATAGTATAAGCAGAATAATTGACTCCGGGCCATTGAATTCCTAGAAAATAATGCATACCCGAGGTGGTAATGCGGCCACGACGTGAAGCAGAGTGTGCATTATTTTCTAAGAATTCAATGGCACGAAGTCAATTATTCCTTAAATATTCTACATCTTAAAAAAGTATGACCAAAGTAAGAATTTTCACTGGAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU92008 True 356 lncRNA 0.39 1 4571198 4571553

Neighbor

gene id symbol gene type direction distance location
CI01000013_04542059_04550082 LCTLB, LCTL coding upstream 20891 4542059 ~ 4550307 (+)
CI01000013_04505188_04527744 NA coding upstream 43326 4505145 ~ 4527872 (+)
CI01000013_04425884_04426805 NA coding upstream 144188 4425748 ~ 4427010 (+)
CI01000013_04344339_04347938 AAGAB coding upstream 223115 4344339 ~ 4348083 (+)
CI01000013_04316134_04317091 NA coding upstream 254000 4316134 ~ 4317198 (+)
CI01000013_04612468_04618550 NA coding downstream 40501 4612054 ~ 4619000 (+)
CI01000013_04657029_04672057 MEGF11 coding downstream 85250 4656803 ~ 4672742 (+)
CI01000013_04673313_04707104 MEGF11 coding downstream 101663 4673216 ~ 4707470 (+)
CI01000013_04720501_04724747 NA coding downstream 148948 4720501 ~ 4724940 (+)
CI01000013_04750261_04754885 NA coding downstream 178708 4750261 ~ 4756045 (+)
G80829 NA non-coding upstream 4195 4566758 ~ 4567003 (+)
G80827 NA non-coding upstream 5851 4565165 ~ 4565347 (+)
G80828 NA non-coding upstream 6541 4563237 ~ 4564657 (+)
G80818 NA non-coding upstream 40583 4530368 ~ 4530615 (+)
G80817 NA non-coding upstream 45549 4525377 ~ 4525649 (+)
G80831 NA non-coding downstream 211 4571764 ~ 4572100 (+)
G80832 NA non-coding downstream 1249 4572802 ~ 4573332 (+)
G80826 NA non-coding downstream 5978 4577531 ~ 4577913 (+)
G80834 NA non-coding downstream 138254 4709807 ~ 4712529 (+)
G80875 NA non-coding downstream 146530 4718083 ~ 4718297 (+)
CI01000013_04051081_04064651 NA other upstream 505369 4050837 ~ 4065829 (+)
G80062 NA other upstream 986414 3584008 ~ 3584784 (+)
G79309 NA other upstream 2104027 2466765 ~ 2467171 (+)
G77695 NA other upstream 3618229 946521 ~ 952969 (+)
G77533 NA other upstream 3861649 708833 ~ 709549 (+)
G80845 NA other downstream 263525 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 1484745 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 1507009 6075400 ~ 6081684 (+)
G81994 NA other downstream 2764392 7335945 ~ 7338239 (+)
G82168 NA other downstream 3456785 8028338 ~ 8041343 (+)

Expression


Co-expression Network