G81380


Basic Information

Item Value
gene id G81380
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 5491058 ~ 5538944 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU92607
AATAAATACAGAAAAAAACAATAATATTGTGAAATATTATTACAATTTAAAATTATGGTTTTCTATTTTAATATACTTTAAAATATAATTTATTTCTGTGATGCAAAGCTGAATTGTCAGCATCATTACTCCAGTCTTCAGTGTCACATGATCCTTCAGCAATCATTCTAATATGTTTCTTGAGCACCAAATTAACATATTAGAATGATTTCTGAAGGATCATGTGACAGTGAAGACTGGAGTAATGACTGCTGTAATGATAATATTTCACACATTAAAAATAAGAAATTTAATCTTGGTTGGGCAAAGTTTTATTTTTAAAGAACCACTCCCATATTTTTCCAGATTGAGCATAATACATTACACATGTACAAGGATGTAAGCTTTGTAAAAGGGATGAATGAGGTGATCCGATAGGTAGAGCTCCTGTTGGCAGCGGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU92607 True 441 lncRNA 0.31 2 5491058 5538944

Neighbor

gene id symbol gene type direction distance location
CI01000013_05436977_05445492 NA coding upstream 45566 5436977 ~ 5445492 (+)
CI01000013_05402289_05403494 NA coding upstream 87131 5401587 ~ 5403927 (+)
CI01000013_05262407_05267780 NA coding upstream 223093 5262129 ~ 5267965 (+)
CI01000013_05246618_05251189 NA coding upstream 239748 5244794 ~ 5251310 (+)
CI01000013_04989803_04992613 NA coding upstream 498170 4989534 ~ 4992888 (+)
CI01000013_05572116_05579830 BBS2 coding downstream 32396 5571340 ~ 5580139 (+)
CI01000013_05583328_05584677 B3GNT9 coding downstream 44384 5583328 ~ 5584704 (+)
CI01000013_05607381_05608529 FOXL1 coding downstream 67939 5606883 ~ 5608570 (+)
CI01000013_05636898_05637901 NA coding downstream 97803 5636747 ~ 5638084 (+)
CI01000013_05698947_05741884 ZFPM1 coding downstream 160003 5698947 ~ 5741884 (+)
G81250 NA non-coding upstream 211120 5279573 ~ 5279938 (+)
G81186 NA non-coding upstream 259641 5203982 ~ 5231417 (+)
G81187 NA non-coding upstream 296371 5194269 ~ 5194687 (+)
G81184 NA non-coding upstream 298481 5192370 ~ 5192577 (+)
G81175 NA non-coding upstream 313000 5177759 ~ 5178058 (+)
G81404 NA non-coding downstream 75960 5614904 ~ 5615250 (+)
G81408 NA non-coding downstream 78882 5617826 ~ 5618111 (+)
G81411 NA non-coding downstream 82739 5621683 ~ 5625346 (+)
G81412 NA non-coding downstream 90686 5629630 ~ 5630428 (+)
G81322 NA non-coding downstream 118592 5657536 ~ 5672245 (+)
G80845 NA other upstream 654826 4835078 ~ 4836232 (+)
CI01000013_04051081_04064651 NA other upstream 1425229 4050837 ~ 4065829 (+)
G80062 NA other upstream 1906274 3584008 ~ 3584784 (+)
G79309 NA other upstream 3023887 2466765 ~ 2467171 (+)
G77695 NA other upstream 4538089 946521 ~ 952969 (+)
CI01000013_06050285_06059640 NA other downstream 517354 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 539618 6075400 ~ 6081684 (+)
G81994 NA other downstream 1797001 7335945 ~ 7338239 (+)
G82168 NA other downstream 2489394 8028338 ~ 8041343 (+)
G82581 NA other downstream 3790385 9329329 ~ 9334948 (+)

Expression


Co-expression Network