G296980



Basic Information


Item Value
gene id G296980
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NW_019172828.1
NCBI id APWO02000046.1
chromosome length 5964967
location 2209670 ~ 2209879 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU408367
ggagagttgaggtgcacattgaattatgttgtgatttgggcagtcgtggttttatgtttttttggatacaatccgggttagcacccgaacatccctttcagacagcttcctcttacagcgtccacagtcaatcctgttggatgtggttggtccttcttggtggtatgctgacattaccctggataccgtggctcttgatgcatcacaaag

Function


GO:

id name namespace
GO:0021532 neural tube patterning biological_process
GO:0021903 rostrocaudal neural tube patterning biological_process
GO:0030917 midbrain-hindbrain boundary development biological_process
GO:0009790 embryo development biological_process

KEGG:

id description
ko04550 Signaling pathways regulating pluripotency of stem cells
ko05217 Basal cell carcinoma

RNA


RNA id representative length rna type GC content exon number start site end site
TU408367 True 210 lncRNA 0.47 1 2209670 2209879

Neighbor


gene id symbol gene type direction distance location
LOC111191055 NA coding downstream 648270 1553406 ~ 1561400 (-)
LOC103045206 LOC108413642 coding downstream 663733 1497029 ~ 1545937 (-)
LOC103044891 fam171a2 coding downstream 715797 1393162 ~ 1493873 (-)
LOC103043375 tcap,LOC108413611 coding downstream 847749 1359317 ~ 1361921 (-)
LOC103043996 LOC108413591 coding downstream 948682 1229707 ~ 1260988 (-)
LOC111191030 NA coding upstream 67487 2277366 ~ 2281361 (-)
trnat-cgu_5 NA coding upstream 71100 2280979 ~ 2281051 (-)
trnar-ucg_44 NA coding upstream 71261 2281140 ~ 2281212 (-)
trnac-aca_6 NA coding upstream 71625 2281504 ~ 2281576 (-)
trnac-aca_7 NA coding upstream 71727 2281606 ~ 2281678 (-)
G296978 NA non-coding downstream 9280 2200179 ~ 2200390 (-)
G296974 NA non-coding downstream 57523 2151918 ~ 2152147 (-)
G296972 NA non-coding downstream 70750 2138713 ~ 2138920 (-)
G296970 NA non-coding downstream 75245 2122421 ~ 2134425 (-)
G296967 NA non-coding downstream 187513 2021777 ~ 2022157 (-)
G296987 NA non-coding upstream 17767 2227646 ~ 2228204 (-)
G296998 NA non-coding upstream 272678 2482557 ~ 2482860 (-)
G297007 NA non-coding upstream 285238 2495117 ~ 2495708 (-)
G297009 NA non-coding upstream 295957 2505836 ~ 2506158 (-)
G297032 NA non-coding upstream 439533 2649412 ~ 2659222 (-)
LOC111191047 NA other downstream 351848 1845913 ~ 1857822 (-)
LOC107197178 syngr1a,LOC108413620,LOC107582870,LOC107694963,LOC107727456,LOC107684634,LOC107725053,LOC107590782 other downstream 820961 1371515 ~ 1388709 (-)
LOC103037146 NA other upstream 287336 2497215 ~ 2531502 (-)
G297195 kpna2,LOC108432045,LOC108261381 other upstream 1014328 3224207 ~ 3227171 (-)
G297334 farsa,LOC106601350 other upstream 1386608 3596487 ~ 3610695 (-)
elof1 elof1,LOC101167459 other upstream 2142736 4352615 ~ 4355768 (-)
G297720 NA other upstream 2155698 4365577 ~ 4366130 (-)

Expression



Co-expression Network