G81864


Basic Information

Item Value
gene id G81864
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 6653940 ~ 6654270 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU93150
GGTGAACTACCCCTTTAATTCAAGCGAATTCCAGTGACAAATCCTTATGCTATGGCATACAATGACATTCTACAGAACCCTTTAGAGGGCCCTTTCTGTTTTGGAATAACAATATCCTGGTGATCTCACTGATCTTGTATCTGAATGGGAGCAAATCCCTTCGTGTTCCAACATCTAATGTAAAGCCTGGTCACACGCTATATTATGTGTTTTTAACTACTATGTATTTACATCAACAAAACAAACAAACAAAAAAACATTGTTAGGGACAAAACACTTCTGCAGCTATTAAGGTGTGAAGCGGGTAAGTTTAGAGACAGGTTTGGTAATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU93150 True 331 lncRNA 0.38 1 6653940 6654270

Neighbor

gene id symbol gene type direction distance location
CI01000013_06635640_06638681 NA coding upstream 14940 6635350 ~ 6639000 (+)
CI01000013_06548714_06565582 PLEKHG7 coding upstream 87817 6547969 ~ 6566123 (+)
CI01000013_06440333_06446814 SSPN coding upstream 206745 6439626 ~ 6447195 (+)
CI01000013_06405275_06423872 SLC6A15 coding upstream 229419 6404196 ~ 6424521 (+)
CI01000013_06311729_06313001 RASSF9 coding upstream 339816 6311729 ~ 6314124 (+)
CI01000013_06705612_06716925 ARNTL2 coding downstream 51342 6705612 ~ 6717106 (+)
CI01000013_06727503_06728691 NA coding downstream 73233 6727503 ~ 6729013 (+)
CI01000013_06737670_06759152 PPFIBP1B, PPFIBP1 coding downstream 83400 6737670 ~ 6759260 (+)
CI01000013_06761450_06763720 NA coding downstream 106767 6761037 ~ 6764263 (+)
CI01000013_06765502_06790599 POLR3B coding downstream 111232 6765502 ~ 6790923 (+)
G81843 NA non-coding upstream 9022 6615518 ~ 6644918 (+)
G81790 NA non-coding upstream 202008 6451725 ~ 6451932 (+)
G81789 NA non-coding upstream 202271 6451459 ~ 6451669 (+)
G81765 NA non-coding upstream 204762 6448563 ~ 6449178 (+)
G81762 NA non-coding upstream 227898 6381822 ~ 6426042 (+)
G81862 NA non-coding downstream 12463 6666733 ~ 6670630 (+)
G81870 NA non-coding downstream 29312 6683582 ~ 6687129 (+)
G81904 NA non-coding downstream 208932 6863202 ~ 6863421 (+)
G81918 NA non-coding downstream 227686 6881956 ~ 6882224 (+)
G81920 NA non-coding downstream 233223 6887493 ~ 6887821 (+)
CI01000013_06076169_06080164 NA other upstream 571573 6075400 ~ 6081684 (+)
CI01000013_06050285_06059640 NA other upstream 594444 6049864 ~ 6060269 (+)
G80845 NA other upstream 1817708 4835078 ~ 4836232 (+)
CI01000013_04051081_04064651 NA other upstream 2588111 4050837 ~ 4065829 (+)
G80062 NA other upstream 3069156 3584008 ~ 3584784 (+)
G81994 NA other downstream 681675 7335945 ~ 7338239 (+)
G82168 NA other downstream 1374068 8028338 ~ 8041343 (+)
G82581 NA other downstream 2675059 9329329 ~ 9334948 (+)
G84005 NA other downstream 2947341 9601611 ~ 9602235 (+)
G84194 NA other downstream 3376338 10030608 ~ 10036953 (+)

Expression


Co-expression Network