G82010


Basic Information

Item Value
gene id G82010
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 7267094 ~ 7267316 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU93335
GCCTGGTACAGTATTGCACTTGCGATGTGAAGTGCTCGTGTAGAAGTCCCATGAAACATGAGTCATGATAAAAGAGCTCAAACAGTTTTAGAAGCAAGCTAAATTGGCATGGTTGCTTTAAAGGCAGGAACACACCAAGCCGACGCCAACAAACTAGTGGCGATGAAAGCAGACTGCGGGGCTGGTTCACGTCGGCAGCGTCTTGGTCCAAAGTTGCCCTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU93335 True 223 lncRNA 0.49 1 7267094 7267316

Neighbor

gene id symbol gene type direction distance location
CI01000013_07154745_07159568 PECR coding upstream 107486 7154745 ~ 7159608 (+)
CI01000013_07148102_07150807 PDF coding upstream 116139 7148052 ~ 7150955 (+)
CI01000013_07131096_07141914 NA coding upstream 125052 7130952 ~ 7142042 (+)
CI01000013_07119401_07124434 TSHZ3A coding upstream 142467 7119401 ~ 7124627 (+)
CI01000013_07093361_07101998 MTSS1LA coding upstream 164726 7093361 ~ 7102368 (+)
CI01000013_07277014_07279249 NA coding downstream 9294 7276610 ~ 7279319 (+)
CI01000013_07286519_07288160 NA coding downstream 19126 7286442 ~ 7288547 (+)
CI01000013_07375912_07390782 MLYCD coding downstream 106502 7373818 ~ 7391003 (+)
CI01000013_07765924_07780475 NA coding downstream 497369 7764685 ~ 7780716 (+)
CI01000013_07791141_07802608 NA coding downstream 523388 7790704 ~ 7802710 (+)
G81985 NA non-coding upstream 74108 7190949 ~ 7192986 (+)
G81939 NA non-coding upstream 181593 6987893 ~ 7085501 (+)
G81883 NA non-coding upstream 361750 6905056 ~ 6905344 (+)
G81920 NA non-coding upstream 379273 6887493 ~ 6887821 (+)
G81918 NA non-coding upstream 384870 6881956 ~ 6882224 (+)
G82013 NA non-coding downstream 2301 7269617 ~ 7269836 (+)
G82017 NA non-coding downstream 8361 7275677 ~ 7275887 (+)
G82045 NA non-coding downstream 72413 7339729 ~ 7340751 (+)
G82050 NA non-coding downstream 81403 7348719 ~ 7352640 (+)
G82061 NA non-coding downstream 141653 7408969 ~ 7409238 (+)
CI01000013_06076169_06080164 NA other upstream 1184727 6075400 ~ 6081684 (+)
CI01000013_06050285_06059640 NA other upstream 1207598 6049864 ~ 6060269 (+)
G80845 NA other upstream 2430862 4835078 ~ 4836232 (+)
CI01000013_04051081_04064651 NA other upstream 3201265 4050837 ~ 4065829 (+)
G80062 NA other upstream 3682310 3584008 ~ 3584784 (+)
G81994 NA other downstream 68629 7335945 ~ 7338239 (+)
G82168 NA other downstream 761022 8028338 ~ 8041343 (+)
G82581 NA other downstream 2062013 9329329 ~ 9334948 (+)
G84005 NA other downstream 2334295 9601611 ~ 9602235 (+)
G84194 NA other downstream 2763292 10030608 ~ 10036953 (+)

Expression


Co-expression Network