G83395


Basic Information

Item Value
gene id G83395
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 7821700 ~ 7822011 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU94848
AAAATTAGAATATTGTGAAAAGGTTCAATATTGAAGACACCTGGTGCCACACTCTAATCAGCTAATTAACTCAAAACACCTGCAAAGGCCTTTAAATGGTCTCTCAGTCTAGTTCTGTAGGCTACACAATCATGGAGAAGACTGCTGACTTGACAGTTGTCCAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGACACAAAAGGTCATTGCAAAAAAGGCTGGCTGTTCACAGAGCTCTGTGTCCAAGCACATTAATAGAGAGGCGAAGGGAAGGAAAAGATGTGGTAGAAAAAAGTGTACAAGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU94848 True 312 lncRNA 0.42 1 7821700 7822011

Neighbor

gene id symbol gene type direction distance location
CI01000013_07804879_07805627 NA coding downstream 16035 7804866 ~ 7805665 (-)
CI01000013_07703864_07718313 NA coding downstream 102627 7703761 ~ 7719073 (-)
CI01000013_07641497_07662151 NA coding downstream 157953 7640917 ~ 7663747 (-)
CI01000013_07463570_07636742 CDH13 coding downstream 184958 7463570 ~ 7636742 (-)
CI01000013_07455026_07456463 NA coding downstream 365194 7454241 ~ 7456506 (-)
CI01000013_07989784_08013498 NA coding upstream 167700 7989711 ~ 8013936 (-)
CI01000013_08016159_08020344 PLCG2 coding upstream 194104 8016115 ~ 8020344 (-)
CI01000013_08042921_08047883 TLDC1 coding upstream 220199 8042210 ~ 8048460 (-)
CI01000013_08059677_08060143 COTL1 coding upstream 236957 8058968 ~ 8060143 (-)
CI01000013_08072726_08076570 NA coding upstream 250568 8072579 ~ 8077191 (-)
G83393 NA non-coding downstream 2335 7819154 ~ 7819365 (-)
G83212 NA non-coding downstream 22746 7773631 ~ 7798954 (-)
G83318 NA non-coding downstream 294902 7521782 ~ 7526798 (-)
G83301 NA non-coding downstream 302153 7471754 ~ 7519547 (-)
G83280 NA non-coding downstream 378401 7442899 ~ 7443299 (-)
G83211 NA non-coding upstream 46759 7868770 ~ 7900168 (-)
G83475 NA non-coding upstream 134951 7956962 ~ 7958056 (-)
G83477 NA non-coding upstream 150729 7972740 ~ 7974429 (-)
G83471 NA non-coding upstream 160173 7982184 ~ 7984602 (-)
G83465 NA non-coding upstream 256803 8078814 ~ 8079209 (-)
CI01000013_07339918_07367774 NA other downstream 439340 7339709 ~ 7367774 (-)
CI01000013_05883498_05884071 CHTF8 other downstream 1937328 5882049 ~ 5884071 (-)
G81547 NA other downstream 2077662 5739526 ~ 5744038 (-)
G81032 NA other downstream 3071139 4748809 ~ 4750561 (-)
CI01000013_04561253_04567647 MAP2K1 other downstream 3262797 4560340 ~ 4567647 (-)
CI01000013_09309438_09335834 MICAL3A other upstream 1485025 9307036 ~ 9336077 (-)
G85170 NA other upstream 2657850 10479861 ~ 10480700 (-)
CI01000013_10564288_10569141 NA other upstream 2741448 10563459 ~ 10569290 (-)
G85188 NA other upstream 2770193 10592204 ~ 10595337 (-)
G85401 NA other upstream 3213021 11035032 ~ 11035466 (-)

Expression


Co-expression Network